BBa_J23095 1 BBa_J23095 Ser2 tRNA key(-28) 2006-11-14T12:00:00Z 2015-08-31T04:08:40Z ser2 tRNA this is a ser2 derived tRNA key with an addressive sequence that anneals 5 bases past the 5' most part of the lock while still completely covering the rbs'. the 3' most base on the lock will be called base (0). so key(0)'s 3'-most binding occurs at base (0) on the lock. key(n)'s 3' most binding occurs at base n. false false _52_ 0 936 52 Not in stock false this is a variant of keys designed to test the key's activation potential with respect to its specific annealling location on the lock while still completely duplexing with the rbs' false bryan hernandez BBa_J23095_sequence 1 ggagagatgccggagcggctgaacggaccgggatccataaaaaaagcaagaggtgattctagttcggtcaaaaaagcttcccggagtaggggcaactctaccgggggttcaaatccccctctctccgcca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z