BBa_J01003 1 OriTR OriT-R (Origin of transfer for the R-plasmid nic region) 2005-10-17T11:00:00Z 2015-08-31T04:08:11Z Released HQ 2013 OriTR, the R plasmid nic region, is where the relaxosome nicks the plasmid and conjugative transfer by R plasmid machinery begins. false false _13_ 0 395 13 In stock false true Golden Bear BBa_J23007 1 BBa_J23007 [key3b] riboregulator for lock3 variants 2006-07-07T11:00:00Z 2015-08-31T04:08:38Z The part is dervied from J01122 J23007 is a derivative of J01129 with a 3 base pair modification. The purpose of J01129 is to "unlock" the "locked" sequence contained in J01122. When J01122 is transcribed the RNA secondary structure is such that the RBS hairpins with sequence upstream preventing the ribosome from binding and translation from occuring thereby locking up RFP further down stream. With the introduction of J01129 (in trans) the hairpin in J01122 can be destroyed. When J01129 is transcribed the RNA secondary structure is that of a hair pin with linear (uninhibited) sequence downstream of the hairpin. This linear sequence preferentially anneals to the stem of the hairpin opposite the RBS on J01122 which destroys the hairpin and frees the RBS allowing translation of RFP to occur. The region on J01129 that binds to the hairpin of J01122 anneals perfectly except for 3 base pairs which are mismatched. J23007 is exactly J01129 except these three base pairs have been corrected for perfect base pairing. false false _52_ 0 936 52 In stock false No design considerations true bryan hernandez BBa_J23121 1 BBa_J23121 J01003::J23007 key3 and OriT (goes with J23120) 2006-10-07T11:00:00Z 2015-08-31T04:08:40Z . see part J23120 false false _52_ 0 363 52 Not in stock false see construction file at http://openwetware.org/wiki/IGEM:UC_Berkeley/2006 for physical construction false Will Bosworth component1902543 1 BBa_J01003 component1902544 1 BBa_J23007 annotation1902544 1 BBa_J23007 range1902544 1 380 406 annotation1902543 1 BBa_J01003 range1902543 1 1 371 BBa_J23121_sequence 1 gccgccttttcctcaatcgctcttcgttcgtctggaaggcagtacaccttgataggtgggctgcccttcctggttggcttggtttcatcagccatccgcttgccctcatctgttacgccggcggtagccggccagcctcgcagagcaggattcccgttgagcaccgccaggtgcgaataagggacagtgaagaaggaacacccgctcgcgggtgggcctacttcacctatcctgcccggctgacgccgttggatacaccaaggaaagtctacacgaaccctttggcaaaatcctgtatatcgtgcgaaaaaggatggatataccgaaaaaatcgctataatgaccccgaagcagggttatgcagcggaaaatactagagacccaaaagcaagaggtgattctagtt BBa_J01003_sequence 1 gccgccttttcctcaatcgctcttcgttcgtctggaaggcagtacaccttgataggtgggctgcccttcctggttggcttggtttcatcagccatccgcttgccctcatctgttacgccggcggtagccggccagcctcgcagagcaggattcccgttgagcaccgccaggtgcgaataagggacagtgaagaaggaacacccgctcgcgggtgggcctacttcacctatcctgcccggctgacgccgttggatacaccaaggaaagtctacacgaaccctttggcaaaatcctgtatatcgtgcgaaaaaggatggatataccgaaaaaatcgctataatgaccccgaagcagggttatgcagcggaaaa BBa_J23007_sequence 1 acccaaaagcaagaggtgattctagtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z