BBa_J23129 1 BBa_J23129 Ser2 tRNA key (-25) 2006-11-23T12:00:00Z 2015-08-31T04:08:41Z j23070 this is a ser2 derived tRNA key with an addressive sequence 27 bp long and whose 5'-most duplex is -25 relative to the start codon[[Template:Berk2006iGEM-J23094-96Notes |.]] {{Berk2006iGEM-J23094-96Notes}} false false _52_ 0 936 52 Not in stock false scanning variant false bryan hernandez BBa_J23129_sequence 1 ggagagatgccggagcggctgaacggaccgggatccataaaaccaaaagcaagaggtgattctagttcgaaaaaagcttcccggagtaggggcaactctaccgggggttcaaatccccctctctccgcca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z