BBa_J24001 1 BBa_J24001 WigLp (Wiggle-dependent Promotor) 2006-06-13T11:00:00Z 2015-08-31T04:08:41Z Fictional Is stimulated by wiggle movement. false false _58_ 0 1016 58 Not in stock false Is inhibited by lethergy false Jamie Lemon annotation1880710 1 WigLp-a range1880710 1 1 22 BBa_J24003 1 BBa_J24003 WigL (codes for wiggling) 2006-06-13T11:00:00Z 2015-08-31T04:08:41Z Purchased from shady Russian street vendor. "A Well Thought-Out Englilsh Paper" by Kyle "The Yellow Dart" Smith Since maybe like the Middle Ages, there have been many differing opinions on hustle and bustle. This cannot be denied. It is my intention to sit down and play video games for several hours. First, moving around quickly, and with purpose, is a true sign of character. Secondarily, bustle(e.g. hustle) yields more product for the working types. "Hustle and bustle are like my right and left arms," said Li'l Spicy in his famous "Hustle and Bustle Are Like My Right and Left Arms" speech. Webster's defines bustle as "excited and often noisy activity; a stir." A stir, indeed. Finally, sometimes gross stuff can be funny. In conclusion, I, "The Yellow Dart," think I have done a great job illustrating the many differing opinions about hustle and bustle, may they both rest in peace. Also, I think Strong Bad should decrease The Cheat's allowance. false false _58_ 0 820 58 Not in stock false Consider design... false Peter Goldstein annotation1880717 1 bustle range1880717 1 21 30 annotation1880716 1 hustle range1880716 1 1 10 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_J24004 1 BBa_J24004 WoM (Wiggle output module, PoPS->WigL+PoPS) 2006-06-13T11:00:00Z 2015-08-31T04:08:41Z Bought from other shady Russian street vendor. "Some factual information for you. Have you any idea how much damage that bulldozer would suffer if I just let it roll straight over you?" "How much?" said Arthur. "None at all," said Mr Prosser, and stormed nervously off wondering why his brain was filled with a thousand hairy horsemen all shouting at him. By a curious coincidence, None at all is exactly how much suspicion the ape-descendant Arthur Dent had that one of his closest friends was not descended from an ape, but was in fact from a small planet in the vicinity of Betelgeuse and not from Guildford as he usually claimed. Arthur Dent had never, ever suspected this. false false _58_ 0 820 58 Not in stock false Design with consideration for others. Also, design *considerably* false Peter Goldstein component1880736 1 BBa_B0012 component1880733 1 BBa_J24003 component1880741 1 BBa_J24001 component1880729 1 BBa_B0032 component1880734 1 BBa_B0010 annotation1880734 1 BBa_B0010 range1880734 1 77 156 annotation1880736 1 BBa_B0012 range1880736 1 165 205 annotation1880729 1 BBa_B0032 range1880729 1 1 13 annotation1880741 1 BBa_J24001 range1880741 1 212 257 annotation1880733 1 BBa_J24003 range1880733 1 22 68 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J24001_sequence 1 atgcggtcaatcatgtatggtacgctagccagtcgatcatcgatcg BBa_J24004_sequence 1 tcacacaggaaagtactagagaaacgcagccataaacgcagccataaacgcagccataaacgcagccatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagatgcggtcaatcatgtatggtacgctagccagtcgatcatcgatcg BBa_B0032_sequence 1 tcacacaggaaag BBa_J24003_sequence 1 aaacgcagccataaacgcagccataaacgcagccataaacgcagcca BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z