BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation1683 1 stem_loop range1683 1 13 35 annotation7019 1 BBa_B0011 range7019 1 1 46 BBa_J24002 1 BBa_J24002 Dance (Coding sequence for Dance gene) 2006-06-13T11:00:00Z 2015-08-31T04:08:41Z Imagination Promoted by WigLP and allows the production of protein Dance. Gives the ability to groove to the music. false false _58_ 0 1017 58 Not in stock false Also inhibited by bad sense of beat. false Annie Gao annotation1880712 1 dance range1880712 1 51 61 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J24005 1 BBa_J24005 Dance Output Module: 'PoPS' -> Dance 2006-06-13T11:00:00Z 2015-08-31T04:08:41Z Standard biological parts of registry Takes input of PoPS and gives output of dance. A composite of RBSa, Dance gene (BBa_J24002), and terminatorA. false false _58_ 0 1017 58 Not in stock false non false Annie Gao component1880726 1 BBa_B0011 component1880719 1 BBa_B0034 component1880722 1 BBa_B0012 component1880721 1 BBa_J24002 annotation1880726 1 BBa_B0011 range1880726 1 498 543 annotation1880721 1 BBa_J24002 range1880721 1 21 440 annotation1880722 1 BBa_B0012 range1880722 1 449 489 annotation1880719 1 BBa_B0034 range1880719 1 1 12 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0034_sequence 1 aaagaggagaaa BBa_J24005_sequence 1 aaagaggagaaatactagaggattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J24002_sequence 1 gattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z