BBa_J24807 1 BBa_J24807 hypothetical activator/repressor of Mer operon 2008-03-19T12:00:00Z 2015-08-31T04:08:43Z This part is protein coding. It comes from plasmid pMOL28 in Ralstonia metallidurans. Link: http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=56550557&from=145400&to=145834&view=gbwithparts We have added a primer that is upstream and compatible with the BioBrick Standard Assembly format. Mediates response to mercury exposure (input) in eubacteria. false false _58_ 0 2518 58 Not in stock false We added in extra nucleotides that are complementary to the upstream and downstream regions on the plasmid to enable PCR reactions to work. false Neil Parikh BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986785 1 -35 range1986785 1 20 25 annotation1986784 1 BBa_R0040 range1986784 1 1 54 BBa_J24809 1 BBa_J24809 Constitutively Expressed merR 2008-03-19T12:00:00Z 2015-08-31T04:08:43Z This is from Ralstonia metallidurans CH34. This is a constitutively expressed merR coding sequence. false false _58_ 0 2518 58 Not in stock false -none- false Neil Parikh component1961804 1 BBa_R0040 component1961808 1 BBa_J24807 annotation1961804 1 BBa_R0040 range1961804 1 1 54 annotation1961808 1 BBa_J24807 range1961808 1 63 511 BBa_J24807_sequence 1 cggagtcaagcgatatggaaaacaatttggagaacctgaccattggcgttttcgccaaggcggccggggtcaatgtggagaccatccgtttctatcagcgcaagggcttgttgctggagcctgacaagccctatggcagcatccgccgctatggcgaggcggatgtaacgcgggtgcgcttcgtgaaatcagcccagcggctgggcttcagcctggatgagatcgccgagctgctgcggctggaggatggcacccattgcgaggaagccagcagtctggccgagcacaagctcaaggacgtgcgcgagaaaatggctgacctggcgcgcatggaggccgtgctgtctgagttggtgtgcgcctgccatgcgcgaagggggaacgtttcctgcccgctgatcgcgtcactacagggtggagcaagcttggcaggttcggctatgccttag BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_J24809_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagcggagtcaagcgatatggaaaacaatttggagaacctgaccattggcgttttcgccaaggcggccggggtcaatgtggagaccatccgtttctatcagcgcaagggcttgttgctggagcctgacaagccctatggcagcatccgccgctatggcgaggcggatgtaacgcgggtgcgcttcgtgaaatcagcccagcggctgggcttcagcctggatgagatcgccgagctgctgcggctggaggatggcacccattgcgaggaagccagcagtctggccgagcacaagctcaaggacgtgcgcgagaaaatggctgacctggcgcgcatggaggccgtgctgtctgagttggtgtgcgcctgccatgcgcgaagggggaacgtttcctgcccgctgatcgcgtcactacagggtggagcaagcttggcaggttcggctatgccttag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z