BBa_J26004 1 SHROOM Mushroom Device 2006-07-24T11:00:00Z 2015-08-31T04:08:44Z false false _77_ 0 768 77 Not in stock false false Patrick King component1894744 1 BBa_J26003 component1894748 1 BBa_B0012 component1894745 1 BBa_J26002 component1894746 1 BBa_B0010 annotation1894748 1 BBa_B0012 range1894748 1 134 174 annotation1894744 1 BBa_J26003 range1894744 1 1 23 annotation1894746 1 BBa_B0010 range1894746 1 46 125 annotation1894745 1 BBa_J26002 range1894745 1 32 37 BBa_J26002 1 MBS Mario Binding Site 2006-07-23T11:00:00Z 2015-08-31T04:08:44Z false false _77_ 0 688 77 Not in stock false false Christian Jacob (hijacked by Patrick King) BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_J26003 1 MUSH Mushroom Activated Promoter 2006-07-23T11:00:00Z 2015-08-31T04:08:44Z false false _ 0 688 77 Not in stock false false Christian Jacob, hijacked by Patrick King BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J26002_sequence 1 gagagg BBa_J26004_sequence 1 gagagagagagagagagatgagttactagaggagaggtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J26003_sequence 1 gagagagagagagagagatgagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z