BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_C0062 1 luxr luxR repressor/activator, (no LVA?) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z <em>V. fischeri</em> <genbank>AF170104</genbank> Released HQ 2013 In complex with HSL, LuxR binds to the Lux promoter, activating transcription from Pr <bb_part>BBa_R0062</bb_part>, and repressing transcription from Pl <bb_part>BBa_R0063</bb_part>. <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the Lux activator, LuxR complexed to HSL. Two molecules of LuxR protein form a complex with two molecules the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription.</p> false true _1_ 0 24 7 In stock false <P> <P>2 silent point mutants were introduced in the coding sequence to remove internal XbaI and PstI sites. Mutation sites were chosen to replace codons commonly used in <em>E. coli</em> with codons used at a similar frequency. <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation1765 1 A range1765 1 492 492 annotation2213986 1 Help:Barcodes range2213986 1 757 781 annotation1762 1 prefix range1762 1 1 2 annotation1764 1 T range1764 1 174 174 annotation7039 1 BBa_C0062 range7039 1 1 756 annotation1766 1 luxR range1766 1 1 750 BBa_R0081 1 AraC O2 Inhibitor (AraC loop attachment with O2 site) 2004-01-29T12:00:00Z 2015-05-08T01:14:15Z Released HQ 2013 this piece of DNA contains a "dead" part of coding region for AraC, and a functional Operator2 site. when attached to the rest of the promoter region, this part allows for the binding and loop formation that would result in repression of the araC promoter false false _1_ 0 24 7 In stock false 1) changed ATG start codon to TAG stop 2) 6 random deletions upstream of putative araC binding sites to preserve spacing for loop back (BB ends will add 6 base pairs); spacing crucial in matching up O2 and I2 binding sites (turns of DNA helix) 3) designed to attach to R0080 to enable all (positive and negative) regulatory functions, and to form "loop back" true Sara Neves (Fighting Darwins) annotation331786 1 stem_loop range331786 1 22 37 annotation331787 1 stem_loop range331787 1 57 72 annotation331785 1 defunct araC range331785 1 1 78 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_I0462 1 LuxR luxR Protein Generator 2003-12-04T12:00:00Z 2015-08-31T04:07:29Z Released HQ 2013 Produces LuxR protein which can sense 3OC<sub>6</sub>HSL in the media and activate transcription from R0062, the right hand Lux promoter false false _1_ 0 24 7 In stock false true Caitlin Conboy and Jennifer Braff component943166 1 BBa_B0034 component943189 1 BBa_B0010 component943199 1 BBa_B0012 component943181 1 BBa_C0062 annotation943199 1 BBa_B0012 range943199 1 896 936 annotation943189 1 BBa_B0010 range943189 1 808 887 annotation943166 1 BBa_B0034 range943166 1 1 12 annotation943181 1 BBa_C0062 range943181 1 19 774 BBa_J28012 1 BBa_J28012 Operon 6 (a) 2006-08-13T11:00:00Z 2015-08-31T04:08:44Z soon soon false false _57_ 0 1072 57 Not in stock false soon false Kaj Bernhardt component2260155 1 BBa_S03549 component2260170 1 BBa_I0462 annotation2260155 1 BBa_S03549 range2260155 1 1 340 annotation2260170 1 BBa_I0462 range2260170 1 349 1284 BBa_S03549 1 BBa_S03549 R0081:R0080 2006-08-13T11:00:00Z 2015-05-08T01:14:24Z false true _57_ 0 1072 57 It's complicated false false Kaj Bernhardt component1895847 1 BBa_R0081 component1895854 1 BBa_R0080 annotation1895847 1 BBa_R0081 range1895847 1 1 183 annotation1895854 1 BBa_R0080 range1895854 1 192 340 BBa_R0080 1 AraC Promoter (AraC regulated) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z GenBank: J01641 (www.ncbi.nlm.nih.gov) Released HQ 2013 AraC operator, truncated to include araO1, araI1, araI2, c-amp1, and c-amp2 sites. This operator should *activate* transcription in the presence of AraC; b/c the operator lacks the araO2 site, there should not be araC-mediated repression. false false _1_ 0 24 7 In stock false true Sara Neves (Fighting Darwins) annotation301457 1 araO1 range301457 1 6 44 annotation301462 1 ara1 and ara2 range301462 1 73 101 annotation301458 1 c-amp1 range301458 1 43 72 annotation301456 1 c-amp2 range301456 1 4 29 annotation308601 1 -35 range308601 1 113 118 annotation308602 1 -10 range308602 1 136 141 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_J28012_sequence 1 caggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgctacagacattgccgtcactggtctttactggctcttctcgctaaccaaaccggtaaccgcttattaaagcattctgtaacaaagcgggaccaaagccatgacaaaactactagaggcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccattactagagaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I0462_sequence 1 aaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0081_sequence 1 caggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgctacagacattgccgtcactggtctttactggctcttctcgctaaccaaaccggtaaccgcttattaaagcattctgtaacaaagcgggaccaaagccatgacaaaac BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_S03549_sequence 1 caggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgctacagacattgccgtcactggtctttactggctcttctcgctaaccaaaccggtaaccgcttattaaagcattctgtaacaaagcgggaccaaagccatgacaaaactactagaggcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccat BBa_C0062_sequence 1 atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac BBa_R0080_sequence 1 gcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z