BBa_J3101 1 RE Recombinational Enhancer (RE) for Hin/Hix inverting 2006-06-01T11:00:00Z 2015-08-31T04:08:45Z false false _61_ 0 918 61 In stock true true Erin Zwack, Sabriya Rosemond annotation1884992 1 Distal Fis Binding Site range1884992 1 55 69 annotation1884988 1 RE Sequence range1884988 1 1 77 annotation1884989 1 Originally a C range1884989 1 29 29 annotation1884990 1 Insertion right before biobrick ends range1884990 1 77 77 annotation1880472 1 Mutation of SpeI site range1880472 1 51 51 annotation1884991 1 Proximal Fis Binding Site range1884991 1 6 21 annotation1880471 1 Former SpeI site range1880471 1 51 56 BBa_J3101_sequence 1 ttcgggtgtcaacaattgaccaaaatattgatttacagcgtaatgcgctttctagtgcaaattgtgaccgcattttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z