BBa_J04031 1 BBa_J04031 GFP w/LVA tag 2005-06-07T11:00:00Z 2015-08-31T04:08:13Z Davidson Synth Aces BBa_E0040 with an LVA tag added via PCR. BBa_E0040 is GFP(mut3b). false true _16_ 0 326 16 It's complicated false false Kristen DeCelle annotation1507202 1 BBa_E0040 range1507202 1 1 720 annotation1507246 1 Start range1507246 1 1 3 annotation1507235 1 LVA range1507235 1 715 753 annotation1507242 1 Double Stop range1507242 1 754 759 BBa_J31017 1 BBa_J31017 produces the RNA crRNA-RBS-GFPLVA-tt 2008-05-08T11:00:00Z 2015-08-31T04:08:45Z BioBrick registry parts produces the RNA crRNA-RBS-GFPLVA-tt, which blocks the RBS andprevents translation of GFP. When the taRNA is present, it will release the crRNA from the RBS and allow for translation. false false _61_ 0 918 61 Not in stock false none false Erin Zwack component1962890 1 BBa_J31014 component1962895 1 BBa_J04031 component1962896 1 BBa_R0010 annotation1962895 1 BBa_J04031 range1962895 1 45 803 annotation1962896 1 BBa_R0010 range1962896 1 812 1011 annotation1962890 1 BBa_J31014 range1962890 1 1 38 BBa_J31014 1 BBa_J31014 crRNA 2007-12-17T12:00:00Z 2015-08-31T04:08:45Z Generated by primer dimer PCR (see Erin Zwack's OWW page for the protocol). The original sequence is a slightly modified version of Isaacs et al.'s riboregulator crRNA. short sequence that is inserted in front of a coding region without an RBS as the part includes an RBS. When in front of the sequence and no taRNA is present, the transcript will not be translated. false false _61_ 0 918 61 Not in stock false The Xba/SpeI scar became the spacer between the coding and RBS; therefore, the first few bases of the crRNA were changed to the reverse complement of the scar. Currently needs to be grown up in dam/- cells in order to cut with Xba. false Erin Zwack BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961227 1 start range1961227 1 173 173 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_J31017_sequence 1 tctagttcacctcttggatttgggtattaaagaggagatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaaaggcctgctgcaaacgacgaaaactacgctttagtagcttaataatactagagcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_J31014_sequence 1 tctagttcacctcttggatttgggtattaaagaggaga BBa_J04031_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaaaggcctgctgcaaacgacgaaaactacgctttagtagcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z