BBa_J31020 1 BBa_J31020 produces taRNA 2008-05-08T11:00:00Z 2015-08-31T04:08:45Z sequence was adapted from a paper by Isaacs et al. 2004 on riboregulators sequence for pBad and taRNA. will release crRNA from RBS and allow translation false false _61_ 0 918 61 Not in stock false the sequence had to be modified to contain the SpeI/XbaI scar in the region that complements the crRNA false Erin Zwack BBa_J31020_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagcacccaaatccaggaggtgatctagagtggtggttaatgaaaattaacttactactaccatatatctctagagactcctgttgatagatccagtaatgacctcagaactccatctggatttgttcagaacgctcggttgccgccgggcgttttttattggtgagaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z