BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23104 1 BBa_J23104 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z isolated from library of promoters replace later false false _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_C0060 1 aiiA autoinducer inactivation enzyme from Bacillus; hydrolyzes acetyl homoserine lactone 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z <genbank>AF196486</genbank> from <em>Bacillus</em> sp. 240B1 putative metallohydrolase (<em>aiiA</em>) gene. <BR> Dong,Y.H., Xu,J.L., Li,X.Z. and Zhang,L.H.: AiiA, an enzyme that inactivates the acylhomoserine lactone quorum-sensing signal and attenuates the virulence of <em>Erwinia<br> carotovora</em>, Proc. Natl. Acad. Sci. U.S.A. 97 (7), 3526-3531 (2000).<br> Released HQ 2013 Coding region for the autoinducer inactivation enzyme A (<em>aiiA</em>) LVA tagged. The gene was originally isolated from <em>Bacillus</em> sp. 240B1 and it encodes an enzyme that catalyzes the degradation of N-acyl homoserine lactones (AHLs)--quorum sensing autoinducers.</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Dong,Y.H., Xu,J.L., Li,X.Z. and Zhang,L.H.: AiiA, an enzyme that inactivates the acylhomoserine lactone quorum-sensing signal and attenuates the virulence of <em>Erwinia<br> carotovora</em>, Proc. Natl. Acad. Sci. U.S.A. 97 (7), 3526-3531 (2000). <a href="#">http://www.pnas.org/cgi/content/full/97/7/3526</a></P> <P>Lee SJ, Park SY, Lee JJ, Yum DY, Koo BT, Lee JK.: Genes encoding the N-acyl homoserine lactone-degrading enzyme are widespread in many subspecies of Bacillus thuringiensis, Appl Environ Microbiol 2002 Aug;68(8):3919-24. <a href="#">http://aem.asm.org/cgi/content/full/68/8/3919?view=full&pmid=12147491</a><br> <br> </P> <P> References (unparsed) here: <p>Dong,Y.H., Xu,J.L., Li,X.Z. and Zhang,L.H.: AiiA, an enzyme that inactivates the acylhomoserine lactone quorum-sensing signal and attenuates the virulence of <em>Erwinia<br> carotovora</em>, Proc. Natl. Acad. Sci. U.S.A. 97 (7), 3526-3531 (2000). <a href="#">http://www.pnas.org/cgi/content/full/97/7/3526</a></P> <P>Lee SJ, Park SY, Lee JJ, Yum DY, Koo BT, Lee JK.: Genes encoding the N-acyl homoserine lactone-degrading enzyme are widespread in many subspecies of Bacillus thuringiensis, Appl Environ Microbiol 2002 Aug;68(8):3919-24. <a href="#">http://aem.asm.org/cgi/content/full/68/8/3919?view=full&pmid=12147491</a><br> <br> </P> <P>BBa_C0060 insert contains open reading frame (nucleotides 49-801) of the GeneBank sequence AF196486 followed by the LVA tag and two double stop codons inserted in the BioBrick prefix and suffix flanking regions. The original stop codon was TAG and in the present sequence it was substituted by TAATAA.<P> true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita D. Marinescu and Alexander D. Wissner-Gross annotation1754 1 start range1754 1 1 3 annotation1755 1 2 range1755 1 784 789 annotation7037 1 BBa_C0060 range7037 1 1 789 annotation1756 1 LVA range1756 1 751 783 annotation2213987 1 Help:Barcodes range2213987 1 790 814 annotation1757 1 aiiA range1757 1 1 750 BBa_K608002 1 BBa_K608002 strong Promoter and strong RBS 2011-09-14T11:00:00Z 2015-05-08T01:12:52Z assembly from iGEM parts Released HQ 2013 you can insert your part behind this part so it will be immediatly expressed in e.coli. false false _780_ 0 9115 9 In stock false cloning via 3a-assembly false Julia M??ller component2128648 1 BBa_B0034 component2128646 1 BBa_J23104 annotation2128646 1 BBa_J23104 range2128646 1 1 35 annotation2128648 1 BBa_B0034 range2128648 1 44 55 BBa_J329053 1 BBa_J329053 Medium AiiA Expression Part 2016-09-13T11:00:00Z 2016-09-14T02:13:30Z N/A. See J329052. false false _2299_ 27001 27001 9 false N/A. false Eric Leaman component2483372 1 BBa_K608002 component2483385 1 BBa_B0015 component2483375 1 BBa_C0060 annotation2483372 1 BBa_K608002 range2483372 1 1 55 annotation2483375 1 BBa_C0060 range2483375 1 62 850 annotation2483385 1 BBa_B0015 range2483385 1 884 1012 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K608002_sequence 1 ttgacagctagctcagtcctaggtattgtgctagctactagagaaagaggagaaa BBa_C0060_sequence 1 atgacagtaaagaagctttatttcgtcccagcaggtcgttgtatgttggatcattcgtctgttaatagtacattaacaccaggagaattattagacttaccggtttggtgttatcttttggagactgaagaaggacctattttagtagatacaggtatgccagaaagtgcagttaataatgaaggtctttttaacggtacatttgtcgaagggcaggttttaccgaaaatgactgaagaagatagaatcgtgaatattttaaaacgggttggttatgagccggaagaccttctttatattattagttctcacttgcattttgatcatgcaggaggaaatggcgcttttataaatacaccaatcattgtacagcgtgctgaatatgaggcggcgcagcatagcgaagaatatttgaaagaatgtatattgccgaatttaaactacaaaatcattgaaggtgattatgaagtcgtaccaggagttcaattattgcatacaccaggccatactccagggcatcaatcgctattaattgagacagaaaaatccggtcctgtattattaacgattgatgcatcgtatacgaaagagaattttgaaaatgaagtgccatttgcgggatttgattcagaattagctttatcttcaattaaacgtttaaaagaagtggtgatgaaagagaagccgattgttttctttggacatgatatagagcaggaaaggggatgtaaagtgttccctgaatatatagctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc BBa_J329053_sequence 1 ttgacagctagctcagtcctaggtattgtgctagctactagagaaagaggagaaatactagatgacagtaaagaagctttatttcgtcccagcaggtcgttgtatgttggatcattcgtctgttaatagtacattaacaccaggagaattattagacttaccggtttggtgttatcttttggagactgaagaaggacctattttagtagatacaggtatgccagaaagtgcagttaataatgaaggtctttttaacggtacatttgtcgaagggcaggttttaccgaaaatgactgaagaagatagaatcgtgaatattttaaaacgggttggttatgagccggaagaccttctttatattattagttctcacttgcattttgatcatgcaggaggaaatggcgcttttataaatacaccaatcattgtacagcgtgctgaatatgaggcggcgcagcatagcgaagaatatttgaaagaatgtatattgccgaatttaaactacaaaatcattgaaggtgattatgaagtcgtaccaggagttcaattattgcatacaccaggccatactccagggcatcaatcgctattaattgagacagaaaaatccggtcctgtattattaacgattgatgcatcgtatacgaaagagaattttgaaaatgaagtgccatttgcgggatttgattcagaattagctttatcttcaattaaacgtttaaaagaagtggtgatgaaagagaagccgattgttttctttggacatgatatagagcaggaaaggggatgtaaagtgttccctgaatatatagctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23104_sequence 1 ttgacagctagctcagtcctaggtattgtgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z