BBa_J33100 1 BBa_J33100 ArsR and Ars Promoter 2006-08-01T11:00:00Z 2015-08-31T04:08:46Z DNA comes from the genomic sequence of E. coli. This part is the ArsR gene and the promoter which the ArsR repressor protein binds to. ArsR binds the promoter in the absence of arsenite and acts as a repressor, and dissociates from the promoter in the presence of arsenite. false false _63_ 0 902 63 Not in stock false We included a ribosome binding site in the sequence to make it easier to use. false Judith Nicholson annotation1893198 1 BBa_J33100 range1893198 1 1 472 annotation1893195 1 ArsR Binding Promoter range1893195 1 1 18 annotation1893197 1 ArsR range1893197 1 119 472 annotation1893196 1 Ribosome Binding Site range1893196 1 108 112 BBa_J33100_sequence 1 ccaactcaaaattcacacctattaccttcctctgcacttacacattcgttaagtcatatatgtttttgacttatccgcttcgaagagagacactacctgcaacaatcaggagcgcaatatgtcatttctgttacccatccaattgttcaaaattcttgctgatgaaacccgtctgggcatcgttttactgctcagcgaactgggagagttatgcgtctgcgatctctgcactgctctcgaccagtcgcagcccaagatctcccgccacctggcattgctgcgtgaaagcgggctattgctggaccgcaagcaaggtaagtgggttcattaccgcttatcaccgcatattccagcatgggcggcgaaaattattgatgaggcctggcgatgtgaacaggaaaaggttcaggcgattgtccgcaacctggctcgacaaaactgttccggggacagtaagaacatttgcagttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z