BBa_J331009 1 BBa_J331009 CSR5 (Metallothionein) 2016-12-03T12:00:00Z 2016-12-03T11:21:39Z Metallothionein. Genomic Sequence This coding region codes for the removal of heavy metals and the purification of substances. It can be used for the removal of lead, mercury, nickel, and others when combined with other biobricks to create a composite part. It was used by Cornell in 2014 to purify water from heavy metals. false false _1979_ 24251 24251 9 false None false Gilles Yvan Buck BBa_J331009_sequence 1 atgactgtaaaaatatgtgactgttaaggcgaatgttgtaaggactcttgtcattgtgggagcacctgccttccaagctgttctggcggtgaaaagtgcaaatgtgatcacagcaccggaagccctcaatgtaagagttgtggtgaaaaatgcaaatgcgaaaccacgtgcacttgtgaaaagagtaaatgcaattgtgaaaaatgttag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z