BBa_J331010 1 BBa_J331010 Linking Sequence for Metallothionein (CRS5) and Glutathione S-Transferase (GST) 2016-12-03T12:00:00Z 2016-12-03T02:29:14Z It comes from a genomic sequence. This is a linking sequence used to link two coding regions (CRS5 and GST) without any RBS. These two are used as part of the process of removing lead (Pb) from water. false false _1979_ 24251 24251 9 false None false Gilles Yvan Buck BBa_J331010_sequence 1 atcggatctggttccgcgtggatccattcata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z