BBa_J33201 1 BBa_J33201 E. coli chromosomal ars promoter with arsR repressor gene 2006-10-12T11:00:00Z 2015-08-31T04:08:46Z The DNA was derived by PCR using genomic DNA from E. coli JM109. Primers were designed based on the sequence reported by Diorio et al (1995), J. Bacteriol 177 (8), 2050-2056, Genbank accession X80057, GI:510824. The sequence given here is derived by sequencing the biobrick construct. Released HQ 2013 This part consists of the promoter of the E. coli JM109 chromosomal arsenic detoxification operon (ars operon), including the ArsR repressor binding site and the arsR gene encoding the arsR repressor protein, together with its ribosome binding site. Addition of any other genes to the 3' end of this part will result in their expression being dependent on the presence of sodium arsenate or sodium arsenite. Arsenite or arsenite anion binds to the repressor protein ArsR, resulting in inability to repress the promoter. Based on our experiments, a concentration of 1 micromolar sodium arsenate in LB is sufficient for essentially full expression, though this will vary according to conditions. false true _63_ 0 837 63 In stock true Note that this sequence includes the arsR gene encoding the ArsR repressor protein, which is thus negatively autoregulated. No additional parts are required for arsenate-induced expression from this part. In principle, this part should also function in hosts other than E. coli. false Chris French annotation1902816 1 arsR range1902816 1 119 472 annotation1902814 1 -10 sequence range1902814 1 80 85 annotation1902812 1 ArsR binding site range1902812 1 36 54 annotation1902813 1 -35 sequence range1902813 1 57 62 annotation1902815 1 rbs range1902815 1 108 112 BBa_J33201_sequence 1 ccaactcaaaattcacacctattaccttcctctgcacttacacattcgttaagtcatatatgtttttgacttatccgcttcgaagagagacactacctgcaacaatcaggagcgcaatatgtcatttctgttacccatccaattgttcaaaattcttgctgatgaaacccgtctgggcatcgttttactgctcagcgaactgggagagttatgcgtctgcgatctctgcactgctctcgaccagtcgcagcccaagatctcccgccacctggcattgctgcgtgaaagcgggctattgctggaccgcaagcaaggtaagtgggttcattaccgcttatcaccgcatattccagcatgggcggcgaaaattattgatgaggcctggcgatgtgaacaggaaaaggttcaggcgattgtccgcaacctggctcgacaaaactgttccggggacagtaagaacatttgcagttaaaaatttagctaaacacatatgaattttcagatgtgttttatccggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z