BBa_J33202 1 BBa_J33202 lacZ 2006-10-12T11:00:00Z 2015-08-31T04:08:46Z The DNA was derived by PCR from E. coli BL21, which possesses an intact lacZ gene. Primers were designed based on sequence from GenBank accession J01636, GI:146575. A stop codon was artificially introduced to replace codon 78. The sequence reported here is derived by sequencing of the Biobrick construct. Released HQ 2013 This gene encodes the N-terminal 77 amino acid residues of LacZ. When expressed in an E. coli host carrying the lacZ-delta-M15 mutation, common in laboratory strains, it complements the delection resulting in the production of active LacZ, which can be detected by various means, including chromogenic substrates such as Xgal (5-bromo-4-chloro-3-indolyl-beta-D-galactoside) and ONPG (o-nitrophenyl galactoside). false false _63_ 0 837 63 In stock true Note that a stop codon was introduced to replace codon 78 of lacZ, resulting in production only of the N-terminal 77 amino acid residues of LacZ. This is sufficient to complement the lacZ-delta-M15 mutation commonly found in laboratory strains of E. col used for alpha-complementation. false Chris French annotation1902818 1 rbs range1902818 1 1 4 annotation1902819 1 lacZ' range1902819 1 13 243 BBa_J33202_sequence 1 gaggaaacagctatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z