BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J34902 1 BBa_J34902 this part measures the happiness level of the cell 2006-07-11T11:00:00Z 2015-08-31T04:08:47Z the oracle measures happiness level of the cell true false _62_ 0 1090 62 Discontinued false none false Dimo Brockhoff, Olga Nikolayeva component1884984 1 BBa_I15008 component1884983 1 BBa_B0034 component1884986 1 BBa_B0021 component1884981 1 BBa_R2002 annotation1884981 1 BBa_R2002 range1884981 1 1 52 annotation1884983 1 BBa_B0034 range1884983 1 61 72 annotation1884984 1 BBa_I15008 range1884984 1 79 804 annotation1884986 1 BBa_B0021 range1884986 1 838 883 BBa_R2002 1 Zif23 Promoter, Zif23 regulated, test: between and after 2004-01-29T12:00:00Z 2015-05-08T01:14:16Z Released HQ 2013 Promoter with standard -10 and -35 sites. A symmetric Zif23 dimer target site is between the -10 and -35 sites, and a symmetric Zif23 dimer target site is after the -10 site. false false _1_ 0 24 7 In stock false consensus sequences based on [Jensen98]. true Ronny Krashinsky annotation318160 1 -35 range318160 1 10 15 annotation318163 1 -10 range318163 1 33 38 annotation318174 1 consensus range318174 1 1 9 annotation318171 1 Zif23 range318171 1 20 33 annotation318164 1 Zif23 range318164 1 39 52 BBa_B0021 1 BBa_B0021 LuxICDABEG (+/-), reversed 2003-10-13T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Bidirectional transcriptional terminator cloned in the reverse direction of B0011. 22 bp stem-loop false true _1_ 0 24 7 In stock false Cloned with primer-dimers into pSB1A2 true Caitlin Conboy annotation7024 1 BBa_B0021 range7024 1 1 46 BBa_I15008 1 BBa_I15008 heme oxygenase (ho1) from Synechocystis 2004-09-19T11:00:00Z 2015-08-31T04:07:38Z Voigt Lab via Anselm Levskaya Released HQ 2013 One of two requisite genes required for the biosynthesis of phycocyanobilin from heme. false false _5_ 0 88 7 In stock true true Jeff Tabor annotation2214026 1 Help:Barcodes range2214026 1 727 751 BBa_B0034_sequence 1 aaagaggagaaa BBa_B0021_sequence 1 aaataataaaaaagccggattaataatctggctttttatattctct BBa_R2002_sequence 1 agtttattcttgacatggtcccacgcgcgtgggatactcccacgcgcgtggg BBa_I15008_sequence 1 atgagtgtcaacttagcttcccagttgcgggaagggacgaaaaaatcccactccatggcggagaacgtcggctttgtcaaatgcttcctcaagggcgttgtcgagaaaaattcctaccgtaagctggttggcaatctctactttgtctacagtgccatggaagaggaaatggcaaaatttaaggaccatcccatcctcagccacatttacttccccgaactcaaccgcaaacaaagcctagagcaagacctgcaattctattacggctccaactggcggcaagaagtgaaaatttctgccgctggccaagcctatgtggaccgagtccggcaagtggccgctacggcccctgaattgttggtggcccattcctacacccgttacctgggggatctttccggcggtcaaattctcaagaaaattgcccaaaatgccatgaatctccacgatggtggcacagctttctatgaatttgccgacattgatgacgaaaaggcttttaaaaatacctaccgtcaagctatgaatgatctgcccattgaccaagccaccgccgaacggattgtggatgaagccaatgacgcctttgccatgaacatgaaaatgttcaacgaacttgaaggcaacctgatcaaggcgatcggcattatggtgttcaacagcctcacccgtcgccgcagtcaaggcagcaccgaagttggcctcgccacctccgaaggctaataacgctgatagtgctagtgtagatcgc BBa_J34902_sequence 1 agtttattcttgacatggtcccacgcgcgtgggatactcccacgcgcgtgggtactagagaaagaggagaaatactagatgagtgtcaacttagcttcccagttgcgggaagggacgaaaaaatcccactccatggcggagaacgtcggctttgtcaaatgcttcctcaagggcgttgtcgagaaaaattcctaccgtaagctggttggcaatctctactttgtctacagtgccatggaagaggaaatggcaaaatttaaggaccatcccatcctcagccacatttacttccccgaactcaaccgcaaacaaagcctagagcaagacctgcaattctattacggctccaactggcggcaagaagtgaaaatttctgccgctggccaagcctatgtggaccgagtccggcaagtggccgctacggcccctgaattgttggtggcccattcctacacccgttacctgggggatctttccggcggtcaaattctcaagaaaattgcccaaaatgccatgaatctccacgatggtggcacagctttctatgaatttgccgacattgatgacgaaaaggcttttaaaaatacctaccgtcaagctatgaatgatctgcccattgaccaagccaccgccgaacggattgtggatgaagccaatgacgcctttgccatgaacatgaaaatgttcaacgaacttgaaggcaacctgatcaaggcgatcggcattatggtgttcaacagcctcacccgtcgccgcagtcaaggcagcaccgaagttggcctcgccacctccgaaggctaataacgctgatagtgctagtgtagatcgctactagagaaataataaaaaagccggattaataatctggctttttatattctct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z