BBa_J35000 1 BBa_J35000 Rothemund DNA origami part 2006-10-17T11:00:00Z 2015-08-31T04:08:47Z Artificial sequence. We use this sequence to insert into staples as a level 1 pixel. false false _64_ 0 807 64 Not in stock false Rothemund PW. Folding DNA to create nanoscale shapes and patterns. Nature. 2006 Mar 16;440(7082):297-302. false Andrey Kuznetsov BBa_J35000_sequence 1 tcctcttttgaggaacaagttttcttgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z