BBa_J35001 1 BBa_J35001 fork hairpin 2006-10-17T11:00:00Z 2015-08-31T04:08:47Z Artificial sequence. We use this sequence to insert it into staples as a level 2 pixel. false false _64_ 0 807 64 Not in stock true OligoAnalyzer 3.0 http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/ false Andrey Kuznetsov BBa_J35001_sequence 1 gcccgcagttttctgcctcgttttcgaggggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z