BBa_J35003 1 3-fingers 3-fingers arm 2006-10-22T11:00:00Z 2015-08-31T04:08:47Z artificial sequence DNA ORIGAMI BioBrick false false _64_ 0 807 64 Not in stock false OligoAnalyzer 3.0 http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/ false Andrey Kuznetsov BBa_J35003_sequence 1 gcccgcagttttctgcctcgttttcgagggagttttctccgggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z