BBa_J36802 1 KaiB KaiB coding region 2006-10-30T12:00:00Z 2015-08-31T04:08:47Z synthetic; GeneArt AG KaiB coding region with an extra stop codon at the end. From Prochlorococcus (Synechococcus) elongatus PCC7942 genome. The actual DNA is synthetic in nature; was synthesized from GeneArt AG. Note that the coding region is bounded by the BioBricks Primers and is on a non-BioBrick vector pPCR-Script (ampR). The biobricks primers can be cut out along with the KaiB coding sequence with KpnI and SacI. The length of the entire plasmid is 3220bp. false false _65_ 0 1189 65 Not in stock false -none- false Zhipeng Sun, Hetmann Hsieh, Jeffrey Lau, David Ramos BBa_J36802_sequence 1 atgagccctcgtaaaacctacattctcaagctctacgtcgccggcaatactccaaactcagtccgtgccctcaaaacgctcaagaacattctcgaagttgaatttcaaggtgtttatgctctaaaggtgatcgatgttctcaaaaatcctcagttggcagaagaggataaaatcctagcgacgccaaccctcgccaaggttctaccactgcctgtccgacggattattggtgatttatccgaccgtgagaaagttttgattggccttgatttactctacggcgaacttcaagattccgacgacttctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z