BBa_J36831 1 LacRBSKaiA Lac+RBS+KaiA 2006-10-25T11:00:00Z 2015-08-31T04:08:47Z Synthetic; GeneArt AG. KaiA coding region with an extra stop codon at the end and two silent mutations at the EcoRI and PstI cut sites. From Prochlorococcus (Synechococcus) elongatus PCC7942 genome. The actual DNA is synthetic in nature; was synthesized from GeneArt AG. false false _65_ 0 1189 65 Not in stock true Removing two biobricks cut sites. false Zhipeng Sun, Hetmann Hsieh, Jeffrey Lau, David Ramos component1909001 1 BBa_J36801 component1908992 1 BBa_R0010 component1909000 1 BBa_B0034 annotation1909001 1 BBa_J36801 range1909001 1 229 1086 annotation1909000 1 BBa_B0034 range1909000 1 209 220 annotation1908992 1 BBa_R0010 range1908992 1 1 200 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961227 1 start range1961227 1 173 173 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J36801 1 KaiA KaiA coding region 2006-10-30T12:00:00Z 2015-08-31T04:08:47Z synthetic; GeneArt AG KaiA coding region with an extra stop codon at the end and two silent mutations at the EcoRI and PstI cut sites. From Prochlorococcus (Synechococcus) elongatus PCC7942 genome. The actual DNA is synthetic in nature; was synthesized from GeneArt AG. Note that the coding region is bounded by the BioBricks Primers and is on a non-BioBrick vector pGA4 (ampR). The biobricks primers can be cut out along with the KaiA coding sequence with HindIII and SacI. Length of entire plasmid is 3802bp. false false _65_ 0 1189 65 Not in stock false -none- false Zhipeng Sun BBa_J36831_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagaggtgctctcgcaaattgcaatctgcatttgggtggaatcgacggcaattttgcaggattgccagcgggcgctgtcggccgatcgctatcaactccaagtctgtgagtctggcgaaatgctcttggagtatgcccaaacccatcgtgaccaaatcgactgcctgattttagtggcagccaatcccagcttcagggcagttgttcagcagctctgctttgagggagtggtggtaccagcgattgtcgtaggcgatcgcgacagtgaggatcccgatgaaccagccaaagaacagctctatcacagcgctgaactgcacctcggtatccatcagctcgagcaattgccctaccaagttgatgctgcactggctgaatttctgcgcttagccccggtcgagaccatggccgaccacatcatgctgatgggggccaaccacgatcccgagctatcgagccagcagcgggacctcgctcagcgactacaagagcgcctaggctatctcggggtctactacaagcgtgatcccgatcgctttctgcgcaacctacccgcctacgaaagccaaaagctgcaccaagcgatgcagactagctatcgtgaaatcgttttgagctatttttcgccgaatagcaacctcaaccagagcattgacaacttcgtcaacatggctttctttgccgatgttccagtcaccaaagtggtagaaattcacatggagctgatggacgagtttgccaagaagctccgcgtagagggacgttcagaggacattttgctggattatcggctgactttaattgatgtaattgcacatctttgtgagatgtatcgacggtctatcccacgagaaacctgatga BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_J36801_sequence 1 gtgctctcgcaaattgcaatctgcatttgggtggaatcgacggcaattttgcaggattgccagcgggcgctgtcggccgatcgctatcaactccaagtctgtgagtctggcgaaatgctcttggagtatgcccaaacccatcgtgaccaaatcgactgcctgattttagtggcagccaatcccagcttcagggcagttgttcagcagctctgctttgagggagtggtggtaccagcgattgtcgtaggcgatcgcgacagtgaggatcccgatgaaccagccaaagaacagctctatcacagcgctgaactgcacctcggtatccatcagctcgagcaattgccctaccaagttgatgctgcactggctgaatttctgcgcttagccccggtcgagaccatggccgaccacatcatgctgatgggggccaaccacgatcccgagctatcgagccagcagcgggacctcgctcagcgactacaagagcgcctaggctatctcggggtctactacaagcgtgatcccgatcgctttctgcgcaacctacccgcctacgaaagccaaaagctgcaccaagcgatgcagactagctatcgtgaaatcgttttgagctatttttcgccgaatagcaacctcaaccagagcattgacaacttcgtcaacatggctttctttgccgatgttccagtcaccaaagtggtagaaattcacatggagctgatggacgagtttgccaagaagctccgcgtagagggacgttcagaggacattttgctggattatcggctgactttaattgatgtaattgcacatctttgtgagatgtatcgacggtctatcccacgagaaacctgatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z