BBa_J36835 1 BBa_J36835 Lipoprotein signal peptide 2006-10-28T11:00:00Z 2015-08-31T04:08:47Z E. coli K12 genome This codes for the 20-amino-acid signal peptide and the 1st nine amino acids of lipoprotein. When fused with another protein downstream, the signal peptide should target the protein to the outer membrane of E. coli, facing the periplasm. This part was fused with OmpA(aa46-66) and OmpA(aa46-159) in trying to express streptavidin protein on the outer surface of E. coli. false false _65_ 0 1229 65 Not in stock true There is no spacer nucleotide between the part and the SpeI restriction site, so that after BioBricks assembly, the mixed site is 6 base pairs, and the reading frame is maintained between protein domains. false Perry Tsai BBa_J36835_sequence 1 atgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z