BBa_J36835 1 BBa_J36835 Lipoprotein signal peptide 2006-10-28T11:00:00Z 2015-08-31T04:08:47Z E. coli K12 genome This codes for the 20-amino-acid signal peptide and the 1st nine amino acids of lipoprotein. When fused with another protein downstream, the signal peptide should target the protein to the outer membrane of E. coli, facing the periplasm. This part was fused with OmpA(aa46-66) and OmpA(aa46-159) in trying to express streptavidin protein on the outer surface of E. coli. false false _65_ 0 1229 65 Not in stock true There is no spacer nucleotide between the part and the SpeI restriction site, so that after BioBricks assembly, the mixed site is 6 base pairs, and the reading frame is maintained between protein domains. false Perry Tsai BBa_J36839 1 BBa_J36839 Lipoprotein signal peptide + Outer membrane protein A, aa 46-159 2006-10-28T11:00:00Z 2015-08-31T04:08:47Z Assembly of BBa_J36835 and BBa_J36837 This part is an assembly of the lipoprotein 20aa signal peptide and its 1st nine amino acids, with amino acids 46-159 of outer membrane protein A. When fused with a protein downstream, this surface display vehicle should express a protein on the outer surface of E. coli. NOTE ABOUT THE SEQUENCE: The mixed site between parts is 'only' six base pairs, ACTAGA. There is no spacer T or G nucleotide. These spacer nucleotides have been placed in the results for "get selected sequence" as an automatic composite-parts addition for the BioBricks mixed site between assembled parts. false false _65_ 0 1229 65 Not in stock true There are no spacer nucleotides between the part and the XbaI restriction site, or between the part and the SpeI restriction site, so that the mixed site would be 6bp long, and reading frame would be maintained between protein domains. Also, the mixed site in between the parts is only six base pairs long, ACTAGA, without the spacer T or G in between parts. false Perry Tsai component1908177 1 BBa_J36837 component1908176 1 BBa_J36835 annotation1908176 1 BBa_J36835 range1908176 1 1 87 annotation1908177 1 BBa_J36837 range1908177 1 96 437 BBa_J36837 1 BBa_J36837 Outer membrane protein A, aa 46-159 2006-10-28T11:00:00Z 2015-08-31T04:08:47Z E. coli K12 This part codes for amino acids #46-159 of outer membrane protein A (OmpA). It corresponds to five transmembrane domains of OmpA, crossing the outer membrane of E. coli. This was fused with the lipoprotein signal peptide upstream and streptavidin downstream in the project to express streptavidin on the outer surface of E. coli. false false _65_ 0 1229 65 Not in stock false There are no spacer nucleotides between the part and the XbaI restriction site, or between the part and the SpeI restriction site, so that the mixed site would be 6bp long, and reading frame would be maintained between protein domains. false Perry Tsai BBa_J36835_sequence 1 atgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcag BBa_J36839_sequence 1 atgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagtactagagaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaac BBa_J36837_sequence 1 aacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z