BBa_J36842 1 BBa_J36842 Streptavidin, dead (no start codon) 2006-10-28T11:00:00Z 2015-08-31T04:08:47Z PCR off a plasmid obtained from Alice Ting's lab at MIT. This part codes for the core part of wild-type streptavidin protein, without the start codon. Streptavidin protein binds strongly to the biotin molecule, and can be used to bind biotinylated nucleic acids or peptides. However, this version has been mutated so that it will not bind biotin strongly. It was used as part of a fusion protein with lipoprotein signal peptide and outer membrane protein A transmembrane domains, to express streptavidin on the outer surface of E. coli. This dead mutant would serve as a type of negative control. false false _65_ 0 1229 65 Not in stock false There was originally a XbaI site TCTAGA at nucleotides 118-123 of the part, which was mutated to AGCCGC. It is missing its start codon at the beginning, as the intention was to fuse this with surface display domains upstream. There are no spacer nucleotides between the part and the XbaI restriction site, or between the part and the SpeI restriction site, so that the mixed site would be 6bp long, and reading frame would be maintained between protein domains. false Perry Tsai BBa_J36842_sequence 1 gctgaagctggtatcaccggcacctggtacgcccagctgggagacaccttcatcgttaccgctggtgctgacggtgctctgaccggtacctacgaagccgctgttggtaacgctgaaagccgctacgttctgaccggtcgttacgactccgctccggctaccgacggttccggaaccgctctgggttggaccgttgcttggaaaaacaactaccgtaacgctcactccgctaccacctggtctggccagtacgttggtggtgctgaagctcgtatcaacacccagtggttgttgacctccggcaccaccgaagctaacgcgtggaaatccaccctggttggtcacgacaccttcaccaaagttaaaccgtccgctgcttcctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z