BBa_J36835 1 BBa_J36835 Lipoprotein signal peptide 2006-10-28T11:00:00Z 2015-08-31T04:08:47Z E. coli K12 genome This codes for the 20-amino-acid signal peptide and the 1st nine amino acids of lipoprotein. When fused with another protein downstream, the signal peptide should target the protein to the outer membrane of E. coli, facing the periplasm. This part was fused with OmpA(aa46-66) and OmpA(aa46-159) in trying to express streptavidin protein on the outer surface of E. coli. false false _65_ 0 1229 65 Not in stock true There is no spacer nucleotide between the part and the SpeI restriction site, so that after BioBricks assembly, the mixed site is 6 base pairs, and the reading frame is maintained between protein domains. false Perry Tsai BBa_J36837 1 BBa_J36837 Outer membrane protein A, aa 46-159 2006-10-28T11:00:00Z 2015-08-31T04:08:47Z E. coli K12 This part codes for amino acids #46-159 of outer membrane protein A (OmpA). It corresponds to five transmembrane domains of OmpA, crossing the outer membrane of E. coli. This was fused with the lipoprotein signal peptide upstream and streptavidin downstream in the project to express streptavidin on the outer surface of E. coli. false false _65_ 0 1229 65 Not in stock false There are no spacer nucleotides between the part and the XbaI restriction site, or between the part and the SpeI restriction site, so that the mixed site would be 6bp long, and reading frame would be maintained between protein domains. false Perry Tsai BBa_J36841 1 BBa_J36841 Streptavidin, wild-type core + His6 tag (no start codon) 2006-10-28T11:00:00Z 2015-08-31T04:08:47Z PCR off a plasmid obtained from Alice Ting's lab at MIT. This part codes for the core part of wild-type streptavidin protein, without the start codon. Streptavidin protein binds strongly to the biotin molecule, and can be used to bind biotinylated nucleic acids or peptides. There is a histidine tag added at the end of the coding sequence right before the stop codons. You can probe for this protein with an anti-his(C-term) antibody. It was used as part of a fusion protein with lipoprotein signal peptide and outer membrane protein A transmembrane domains, to express streptavidin on the outer surface of E. coli. false false _65_ 0 1229 65 Not in stock true There was originally a XbaI site TCTAGA at nucleotides 118-123 of the part, which was mutated to AGCCGC. It is missing its start codon at the beginning, as the intention was to fuse this with surface display domains upstream. There are no spacer nucleotides between the part and the XbaI restriction site, or between the part and the SpeI restriction site, so that the mixed site would be 6bp long, and reading frame would be maintained between protein domains. false Perry Tsai BBa_J36846 1 BBa_J36846 Lpp-OmpA(46-159)-Streptavidin wild-type + His6 2006-10-30T12:00:00Z 2015-08-31T04:08:47Z Assembly of J36835, J36837, J36841 Assembled construct of signal peptide of lipoprotein, five transmembrane domains of outer membrane protein A, and streptavidin, wild-type with His6 tag at the end. This construct codes for a protein which displays streptavidin on the cell surface. false false _65_ 0 1229 65 It's complicated true There are no spacer nucleotides between the part and the XbaI restriction site, or between the part and the SpeI restriction site, so that the mixed site would be 6bp long, and reading frame would be maintained between protein domains. Also, the mixed site in between the parts is only six base pairs long, ACTAGA, without the spacer T or G in between parts. true Perry Tsai component1909023 1 BBa_J36835 component1909025 1 BBa_J36841 component1909024 1 BBa_J36837 annotation1909025 1 BBa_J36841 range1909025 1 446 850 annotation1909023 1 BBa_J36835 range1909023 1 1 87 annotation1909024 1 BBa_J36837 range1909024 1 96 437 BBa_J36846_sequence 1 atgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagtactagagaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaactactagaggctgaagctggtatcaccggcacctggtacaaccagctgggatccaccttcatcgttaccgctggtgctgacggtgctctgaccggtacctacgaatccgctgttggtaacgctgaaagccgctacgttctgaccggtcgttacgactccgctccggctaccgacggttccggaaccgctctgggttggaccgttgcttggaaaaacaactaccgtaacgctcactccgctaccacctggtctggccagtacgttggtggtgctgaagctcgtatcaacacccagtggttgttgacctccggcaccaccgaagccaacgcgtggaaatccaccctggttggtcacgacaccttcaccaaagttaaaccgtccgctgcttcccatcaccatcaccaccattaataa BBa_J36841_sequence 1 gctgaagctggtatcaccggcacctggtacaaccagctgggatccaccttcatcgttaccgctggtgctgacggtgctctgaccggtacctacgaatccgctgttggtaacgctgaaagccgctacgttctgaccggtcgttacgactccgctccggctaccgacggttccggaaccgctctgggttggaccgttgcttggaaaaacaactaccgtaacgctcactccgctaccacctggtctggccagtacgttggtggtgctgaagctcgtatcaacacccagtggttgttgacctccggcaccaccgaagccaacgcgtggaaatccaccctggttggtcacgacaccttcaccaaagttaaaccgtccgctgcttcccatcaccatcaccaccattaataa BBa_J36835_sequence 1 atgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcag BBa_J36837_sequence 1 aacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z