BBa_J36835 1 BBa_J36835 Lipoprotein signal peptide 2006-10-28T11:00:00Z 2015-08-31T04:08:47Z E. coli K12 genome This codes for the 20-amino-acid signal peptide and the 1st nine amino acids of lipoprotein. When fused with another protein downstream, the signal peptide should target the protein to the outer membrane of E. coli, facing the periplasm. This part was fused with OmpA(aa46-66) and OmpA(aa46-159) in trying to express streptavidin protein on the outer surface of E. coli. false false _65_ 0 1229 65 Not in stock true There is no spacer nucleotide between the part and the SpeI restriction site, so that after BioBricks assembly, the mixed site is 6 base pairs, and the reading frame is maintained between protein domains. false Perry Tsai BBa_J36843 1 BBa_J36843 Streptavidin, single-chain dimer + His6 tag (no start codon) 2006-10-28T11:00:00Z 2015-08-31T04:08:47Z PCR off a plasmid from Filiz Aslan at Boston University. This part codes for the single-chain dimer of streptavidin protein, without the start codon. Streptavidin protein binds strongly to the biotin molecule, and can be used to bind biotinylated nucleic acids or peptides. There is a histidine tag added at the end of the coding sequence right before the stop codons. You can probe for this protein with an anti-his(C-term) antibody. It was used as part of a fusion protein with lipoprotein signal peptide and outer membrane protein A transmembrane domains, to express streptavidin on the outer surface of E. coli. Streptavidin exists naturally as a tetramer, so this dimer form was attempted as a better binder of biotin than a monomeric form on the cell surface. NOTE: According to sequencing, the SpeI site ACTAGT encountered a mutation to ATTAGT. Also, this part exists currently in pCR-Topo2.1 vector. false true _65_ 0 1229 65 Not in stock true There was a PstI site CTGCAG at nucleotides 617-622 of the part, which was mutated to CTGCGG. There are no spacer nucleotides between the part and the XbaI restriction site, or between the part and the SpeI restriction site, so that the mixed site would be 6bp long, and reading frame would be maintained between protein domains. false Perry Tsai BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J36837 1 BBa_J36837 Outer membrane protein A, aa 46-159 2006-10-28T11:00:00Z 2015-08-31T04:08:47Z E. coli K12 This part codes for amino acids #46-159 of outer membrane protein A (OmpA). It corresponds to five transmembrane domains of OmpA, crossing the outer membrane of E. coli. This was fused with the lipoprotein signal peptide upstream and streptavidin downstream in the project to express streptavidin on the outer surface of E. coli. false false _65_ 0 1229 65 Not in stock false There are no spacer nucleotides between the part and the XbaI restriction site, or between the part and the SpeI restriction site, so that the mixed site would be 6bp long, and reading frame would be maintained between protein domains. false Perry Tsai BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961227 1 start range1961227 1 173 173 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 BBa_J36851 1 BBa_J36851 Lac-inducible generator of Lpp-OmpA(46-159)-Streptavidin single-chain dimeric + His6 tag 2006-10-28T11:00:00Z 2015-08-31T04:08:47Z PCR off a plasmid obtained from Alice Ting's lab at MIT. This part codes for the core part of wild-type streptavidin protein, without the start codon. Streptavidin protein binds strongly to the biotin molecule, and can be used to bind biotinylated nucleic acids or peptides. However, this version has been mutated so that it will not bind biotin strongly. It was used as part of a fusion protein with lipoprotein signal peptide and outer membrane protein A transmembrane domains, to express streptavidin on the outer surface of E. coli. This dead mutant would serve as a type of negative control. false false _65_ 0 1229 65 It's complicated false There was originally a XbaI site TCTAGA at nucleotides 118-123 of the part, which was mutated to AGCCGC. It is missing its start codon at the beginning, as the intention was to fuse this with surface display domains upstream. There are no spacer nucleotides between the part and the XbaI restriction site, or between the part and the SpeI restriction site, so that the mixed site would be 6bp long, and reading frame would be maintained between protein domains. false Perry Tsai component1909419 1 BBa_R0010 component1909429 1 BBa_J36837 component1909430 1 BBa_J36843 component1909427 1 BBa_B0034 component1909428 1 BBa_J36835 annotation1909428 1 BBa_J36835 range1909428 1 227 313 annotation1909429 1 BBa_J36837 range1909429 1 322 663 annotation1909419 1 BBa_R0010 range1909419 1 1 200 annotation1909430 1 BBa_J36843 range1909430 1 672 1490 annotation1909427 1 BBa_B0034 range1909427 1 209 220 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_J36835_sequence 1 atgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcag BBa_J36843_sequence 1 gaggccaacgccaagaagtccacgctggtcggccacgacaccttcaccaaggtgaagccgtccgccgcctccggtggtggatctgcggaggtcggcatcaccggcacctggtacaaccagctcggctcgaccttcatcgtgaccgcgggcgccgacggcgccctgaccggaacctacgagtcggccgtcggcaacgccgagagccgctacgtcctgaccggtcgttacgacagcgccccggccaccgacggcagcggcaccgccctcggttggacggtggcctggaagaataactaccgcaacgcccactccgcgaccacgtggagcggccagtacgtcggcggcgccgaggcgaggatcaacacccagtggctgctgacctccggcaccggctccggaaccgccctcggttggacggtggcctggaagaataactaccgcaacgcccactccgcgaccacgtggagcggccagtacgtcggcggcgccgaggcgaggatcaacacccagtggctgctgacctccggcaccaccgaggccaacgcctggaagtccacgctggtcggccacgacaccttcaccaaggtgaagccgtccgccgcctccggtggtggatctgcggaggtcggcatcaccggcacctggtacaaccagctcggctcgaccttcatcgtgaccgcgggcgccgacggcgccctgaccggaacctacgagtcggccgtcggcaacgccgagagccgctacgtcctgaccggtcgttacgacagcgccccggccaccgacggcgcggccgcactcgagcaccaccaccaccactga BBa_J36837_sequence 1 aacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaac BBa_J36851_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagtactagagaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaactactagaggaggccaacgccaagaagtccacgctggtcggccacgacaccttcaccaaggtgaagccgtccgccgcctccggtggtggatctgcggaggtcggcatcaccggcacctggtacaaccagctcggctcgaccttcatcgtgaccgcgggcgccgacggcgccctgaccggaacctacgagtcggccgtcggcaacgccgagagccgctacgtcctgaccggtcgttacgacagcgccccggccaccgacggcagcggcaccgccctcggttggacggtggcctggaagaataactaccgcaacgcccactccgcgaccacgtggagcggccagtacgtcggcggcgccgaggcgaggatcaacacccagtggctgctgacctccggcaccggctccggaaccgccctcggttggacggtggcctggaagaataactaccgcaacgcccactccgcgaccacgtggagcggccagtacgtcggcggcgccgaggcgaggatcaacacccagtggctgctgacctccggcaccaccgaggccaacgcctggaagtccacgctggtcggccacgacaccttcaccaaggtgaagccgtccgccgcctccggtggtggatctgcggaggtcggcatcaccggcacctggtacaaccagctcggctcgaccttcatcgtgaccgcgggcgccgacggcgccctgaccggaacctacgagtcggccgtcggcaacgccgagagccgctacgtcctgaccggtcgttacgacagcgccccggccaccgacggcgcggccgcactcgagcaccaccaccaccactga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z