BBa_J36843 1 BBa_J36843 Streptavidin, single-chain dimer + His6 tag (no start codon) 2006-10-28T11:00:00Z 2015-08-31T04:08:47Z PCR off a plasmid from Filiz Aslan at Boston University. This part codes for the single-chain dimer of streptavidin protein, without the start codon. Streptavidin protein binds strongly to the biotin molecule, and can be used to bind biotinylated nucleic acids or peptides. There is a histidine tag added at the end of the coding sequence right before the stop codons. You can probe for this protein with an anti-his(C-term) antibody. It was used as part of a fusion protein with lipoprotein signal peptide and outer membrane protein A transmembrane domains, to express streptavidin on the outer surface of E. coli. Streptavidin exists naturally as a tetramer, so this dimer form was attempted as a better binder of biotin than a monomeric form on the cell surface. NOTE: According to sequencing, the SpeI site ACTAGT encountered a mutation to ATTAGT. Also, this part exists currently in pCR-Topo2.1 vector. false true _65_ 0 1229 65 Not in stock true There was a PstI site CTGCAG at nucleotides 617-622 of the part, which was mutated to CTGCGG. There are no spacer nucleotides between the part and the XbaI restriction site, or between the part and the SpeI restriction site, so that the mixed site would be 6bp long, and reading frame would be maintained between protein domains. false Perry Tsai BBa_J36852 1 BBa_J36852 Streptavidin, single-chain dimer (no start codon) 2006-10-28T11:00:00Z 2015-08-31T04:08:47Z PCR off a plasmid from Filiz Aslan at Boston University. This part codes for the single-chain dimer of streptavidin protein, without the start codon. Streptavidin protein binds strongly to the biotin molecule, and can be used to bind biotinylated nucleic acids or peptides. It was used as part of a fusion protein with lipoprotein signal peptide and outer membrane protein A transmembrane domains, to express streptavidin on the outer surface of E. coli. Streptavidin exists naturally as a tetramer, so this dimer form was attempted as a better binder of biotin than a monomeric form on the cell surface. NOTE: According to sequencing, the SpeI site ACTAGT encountered a mutation to ATTAGT. Also, this part exists currently in pCR-Topo2.1 vector. true false _65_ 0 1229 65 Discontinued false There was a PstI site CTGCAG at nucleotides 617-622 of the part, which was mutated to CTGCGG. There are no spacer nucleotides between the part and the XbaI restriction site, or between the part and the SpeI restriction site, so that the mixed site would be 6bp long, and reading frame would be maintained between protein domains. false Perry Tsai BBa_J36843_sequence 1 gaggccaacgccaagaagtccacgctggtcggccacgacaccttcaccaaggtgaagccgtccgccgcctccggtggtggatctgcggaggtcggcatcaccggcacctggtacaaccagctcggctcgaccttcatcgtgaccgcgggcgccgacggcgccctgaccggaacctacgagtcggccgtcggcaacgccgagagccgctacgtcctgaccggtcgttacgacagcgccccggccaccgacggcagcggcaccgccctcggttggacggtggcctggaagaataactaccgcaacgcccactccgcgaccacgtggagcggccagtacgtcggcggcgccgaggcgaggatcaacacccagtggctgctgacctccggcaccggctccggaaccgccctcggttggacggtggcctggaagaataactaccgcaacgcccactccgcgaccacgtggagcggccagtacgtcggcggcgccgaggcgaggatcaacacccagtggctgctgacctccggcaccaccgaggccaacgcctggaagtccacgctggtcggccacgacaccttcaccaaggtgaagccgtccgccgcctccggtggtggatctgcggaggtcggcatcaccggcacctggtacaaccagctcggctcgaccttcatcgtgaccgcgggcgccgacggcgccctgaccggaacctacgagtcggccgtcggcaacgccgagagccgctacgtcctgaccggtcgttacgacagcgccccggccaccgacggcgcggccgcactcgagcaccaccaccaccactga BBa_J36852_sequence 1 gaggccaacgccaagaagtccacgctggtcggccacgacaccttcaccaaggtgaagccgtccgccgcctccggtggtggatctgcggaggtcggcatcaccggcacctggtacaaccagctcggctcgaccttcatcgtgaccgcgggcgccgacggcgccctgaccggaacctacgagtcggccgtcggcaacgccgagagccgctacgtcctgaccggtcgttacgacagcgccccggccaccgacggcagcggcaccgccctcggttggacggtggcctggaagaataactaccgcaacgcccactccgcgaccacgtggagcggccagtacgtcggcggcgccgaggcgaggatcaacacccagtggctgctgacctccggcaccggctccggaaccgccctcggttggacggtggcctggaagaataactaccgcaacgcccactccgcgaccacgtggagcggccagtacgtcggcggcgccgaggcgaggatcaacacccagtggctgctgacctccggcaccaccgaggccaacgcctggaagtccacgctggtcggccacgacaccttcaccaaggtgaagccgtccgccgcctccggtggtggatctgcggaggtcggcatcaccggcacctggtacaaccagctcggctcgaccttcatcgtgaccgcgggcgccgacggcgccctgaccggaacctacgagtcggccgtcggcaacgccgagagccgctacgtcctgaccggtcgttacgacagcgccccggccaccgacggcgcggccgcactcgagcaccaccaccaccactga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z