BBa_J36858 1 BBa_J36858 S20 linkaptamer 2006-10-28T11:00:00Z 2015-08-31T04:08:47Z synthetic S20 is the streptavidin-binding component of the A20 adaptamer which can physically link together the proteins thrombin and streptavidin. A20 contains a 15 bp double-stranded linking region between thrombin and streptavidin aptamer sequences. false false _65_ 0 1245 65 Not in stock true Linking region had to avoid disruption of aptamer secondary structure. false Lewis Hahn BBa_J36858_sequence 1 tctgtgagacgacgcaccggtcgcaggttttgtctcacagtttgctaatcctttccatac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z