BBa_J37004 1 BBa_J37004 Learning parts 2006-07-02T11:00:00Z 2015-08-31T04:08:47Z Learning parts Learning parts false false _66_ 0 911 66 Not in stock false Learning parts false Chueh-Loo Poh component1883385 1 BBa_B0024 component1883386 1 BBa_B0023 annotation1883386 1 BBa_B0023 range1883386 1 104 150 annotation1883385 1 BBa_B0024 range1883385 1 1 95 BBa_B0024 1 BBa_B0024 double terminator (B0012-B0011), reversed 2003-12-02T12:00:00Z 2015-08-31T04:07:20Z -- No description -- false false _1_ 0 24 7 In stock false true Caitlin Conboy BBa_B0023 1 BBa_B0023 TE from coliphage T7, reversed 2003-10-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 This part is the reverse of terminator B0013, a bacteriophage T7 terminator which was engineered to be bidirectional. Contains a poly A insertion upstream of a 20 bp stem-loop. false false _1_ 0 24 7 In stock false false Caitlin Conboy BBa_B0024_sequence 1 aaataataaaaaagccggattaataatctggctttttatattctctctctagtatataaacgcagaaaggcccacccgaaggtgagccagtgtga BBa_J37004_sequence 1 aaataataaaaaagccggattaataatctggctttttatattctctctctagtatataaacgcagaaaggcccacccgaaggtgagccagtgtgatactagagtataaacgcaaaaaggcccacccgaaggtgagccagtttgatttttt BBa_B0023_sequence 1 tataaacgcaaaaaggcccacccgaaggtgagccagtttgatttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z