BBa_J37005 1 BBa_J37005 self-destruct DNA 2006-07-05T11:00:00Z 2015-08-31T04:08:47Z An investigation into self-destructing DNA sequences, Nature, John Sy Expression of this gene will cause apoptosis of the cell stopping production of ATP from mitochondrion false false _66_ 0 1052 66 Not in stock false Had to deal with cells destructing before doing anything useful false John Sy annotation1883501 1 Preparing Cell Death range1883501 1 30 40 annotation1883508 1 Giving the cell a dose of it range1883508 1 61 110 annotation1883493 1 Cell Death Begin range1883493 1 11 20 BBa_J37005_sequence 1 aggtcagctagtcgtacgtacgtacgtgctagctagctgactagctgatcgattattgctattacgcggattagcggatcttagcttcgagtcgatcgtatctcgatcgtatcgtgcccgagcgctgactgatcgtagtgatgcatcga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z