BBa_J37007 1 BBa_J37007 Dummy Part 2006-07-05T11:00:00Z 2015-08-31T04:08:47Z Comes from a genomic sequence. Watch this space;-)!!! false false _66_ 0 1065 66 Not in stock false Make it modular. false Farah Vohra annotation1883499 1 Farah range1883499 1 1 10 annotation1883503 1 Vohra range1883503 1 11 20 annotation1883509 1 BioBrick range1883509 1 21 25 BBa_J37007_sequence 1 aaaattttccccgggcgcgcgcgcaaaattttccccgggcgcgcgcgcaaaattttccccgggcgcgcgcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z