BBa_J37026 1 BBa_J37026 Lox 66 2006-07-31T11:00:00Z 2015-08-31T04:08:48Z Zuwen Zhang and Beat Lutz (2002) Cre Recombinase-mediated inversion using lox66 and lox71: method to introduce conditional point mutations into the CREB-binding protein NUCLEAIC ACIDS RESEARCH This is a mutated sequence taken from (Zhang and Lutz 2002) It is a Lox site which can be bound by The enzyme Cre Recombinase false true _66_ 0 1068 66 In stock false NA false John Chattaway BBa_J37026_sequence 1 ataacttggtatagcatacattatacgaacggta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z