BBa_J37027 1 BBa_J37027 Pops Blocker (Cre/Lox system) 2006-07-31T11:00:00Z 2015-08-31T04:08:48Z From Regestry: BBa_B0015 BBa_I13521 Lox Sites: Zuwen Zhang and Beat Lutz (2002) Cre Recombinase-mediated inversion using lox66 and lox71: method to introduce conditional point mutations into the CREB-binding protein NUCLEAIC ACIDS RESEARCH This part is designed to be placed downstream of a promoter and prevent any Pops from the Promoter passing through this part. It will do this until an accompanying Cre Recombinase plasmid becomes activated. Once the Cre recombinase is activated the enzyme produced will permanently cut a section of DNA from the plasmid containing this part. This short section of DNA contains stop codons so once these are removed the polymerase can pass through this part and transcribe downstream genes. This short section of DNA is degraded. This is useful if a component of the system must be grown up but not activated until a certain external stimulus is added such as a positive feedback loop. This part should be very efficient at preventing Pops passing through it. The Part also contains a RFP reporter which is transcribed in the 3???-5??? direction. This means that un-activated parts will fluoresce red and activated parts will not fluoresce. This allows you to see that the part is working in your system. It also allows you to observe the efficiency of activation of the part in your system. Because of the way Cre recombinase works the excised reporter will remain in a small plasmid and continue to be transcribed for a short time however this plasmid will not have an origin of replication so will not be copied and the fluorescent protein should stop being produced after around 15min The design uses mutated lox sites, lox66 and lox71, which will make the excision irreversible. Reference: Zuwen Zhang and Beat Lutz (2002) Cre Recombinase-mediated inversion using lox66 and lox71: method to introduce conditional point mutations into the CREB-binding protein NUCLEAIC ACIDS RESEARCH false false _66_ 0 1068 66 It's complicated true Used specific lox sites to make this irreversable true John Chattaway annotation1893183 1 stop range1893183 1 158 158 annotation1893182 1 polya range1893182 1 152 165 annotation1893180 1 BBa_B0012 range1893180 1 125 165 annotation1893188 1 Reversed and complementary to part I13521 range1893188 1 168 1091 annotation1893179 1 stem_loop range1893179 1 48 91 annotation1893184 1 BBa_J37028 range1893184 1 1094 1127 annotation1893178 1 BBa_B0010 range1893178 1 37 116 annotation1893177 1 BBa_J37026 range1893177 1 1 34 annotation1893181 1 T7 TE range1893181 1 132 151 BBa_J37027_sequence 1 cgataacttggtatagcatacattatacgaacggtaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatagattataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggctctagtagcgatctacactagcactatcagcgttattaagcaccggtggagtgacgaccttcagcacgttcgtactgttcaacgatggtgtagtcttcgttgtgggaggtgatgtccagtttgatgtcggttttgtaagcacccggcagctgaaccggttttttagccatgtaggtggttttaacttcagcgtcgtagtgaccaccgtctttcagtttcagacgcattttgatttcacctttcagagcaccgtcttccgggtacatacgttcggtggaagcttcccaacccatggtttttttctgcataaccggaccgtcggacgggaagttggtaccacgcagtttaactttgtagatgaactcaccgtcttgcagggaggagtcctgggtaacggtaacaacaccaccgtcttcgaagttcataacacgttcccatttgaaaccttccgggaaggacagtttcaggtagtccgggatgtcagccgggtgtttaacgtaagctttggaaccgtactggaactgcggggacaggatgtcccaagcgaacggcagcggaccacctttggtaactttcagtttagcggtctgggtaccttcgtacggacgaccttcaccttcaccttcgatttcgaactcgtgaccgttaacggaaccttccatacgaactttgaaacgcatgaactctttgataacgtcttcggaggaagccatctagtatttctcctctttctctagtagtgctcagtatctctatcactgatagggatgtcaatctctatcactgatagggagttaccgttcgtatacgatacattatacgaagttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z