BBa_J37038 1 BBa_J37038 This device is to test the Pops Blocker part 2006-09-12T11:00:00Z 2015-08-31T04:08:48Z registry This device is to test the Pops Blocker part J37027 false false _66_ 0 1068 66 Not in stock false none false John Chattaway component1901709 1 BBa_J37027 component1901698 1 BBa_B0030 component1901712 1 BBa_B0012 component1901710 1 BBa_B0010 component1901693 1 BBa_R0040 component1901703 1 BBa_B0012 component1901701 1 BBa_B0010 annotation1901703 1 BBa_B0012 range1901703 1 210 250 annotation1901709 1 BBa_J37027 range1901709 1 86 1212 annotation1901712 1 BBa_B0012 range1901712 1 1309 1349 annotation1901693 1 BBa_R0040 range1901693 1 1 54 annotation1901701 1 BBa_B0010 range1901701 1 122 201 annotation1901710 1 BBa_B0010 range1901710 1 1221 1300 annotation1901698 1 BBa_B0030 range1901698 1 63 77 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986787 1 -10 range1986787 1 43 48 annotation1986785 1 -35 range1986785 1 20 25 annotation1986784 1 BBa_R0040 range1986784 1 1 54 BBa_J37027 1 BBa_J37027 Pops Blocker (Cre/Lox system) 2006-07-31T11:00:00Z 2015-08-31T04:08:48Z From Regestry: BBa_B0015 BBa_I13521 Lox Sites: Zuwen Zhang and Beat Lutz (2002) Cre Recombinase-mediated inversion using lox66 and lox71: method to introduce conditional point mutations into the CREB-binding protein NUCLEAIC ACIDS RESEARCH This part is designed to be placed downstream of a promoter and prevent any Pops from the Promoter passing through this part. It will do this until an accompanying Cre Recombinase plasmid becomes activated. Once the Cre recombinase is activated the enzyme produced will permanently cut a section of DNA from the plasmid containing this part. This short section of DNA contains stop codons so once these are removed the polymerase can pass through this part and transcribe downstream genes. This short section of DNA is degraded. This is useful if a component of the system must be grown up but not activated until a certain external stimulus is added such as a positive feedback loop. This part should be very efficient at preventing Pops passing through it. The Part also contains a RFP reporter which is transcribed in the 3???-5??? direction. This means that un-activated parts will fluoresce red and activated parts will not fluoresce. This allows you to see that the part is working in your system. It also allows you to observe the efficiency of activation of the part in your system. Because of the way Cre recombinase works the excised reporter will remain in a small plasmid and continue to be transcribed for a short time however this plasmid will not have an origin of replication so will not be copied and the fluorescent protein should stop being produced after around 15min The design uses mutated lox sites, lox66 and lox71, which will make the excision irreversible. Reference: Zuwen Zhang and Beat Lutz (2002) Cre Recombinase-mediated inversion using lox66 and lox71: method to introduce conditional point mutations into the CREB-binding protein NUCLEAIC ACIDS RESEARCH false false _66_ 0 1068 66 It's complicated true Used specific lox sites to make this irreversable true John Chattaway annotation1893183 1 stop range1893183 1 158 158 annotation1893182 1 polya range1893182 1 152 165 annotation1893180 1 BBa_B0012 range1893180 1 125 165 annotation1893188 1 Reversed and complementary to part I13521 range1893188 1 168 1091 annotation1893179 1 stem_loop range1893179 1 48 91 annotation1893184 1 BBa_J37028 range1893184 1 1094 1127 annotation1893177 1 BBa_J37026 range1893177 1 1 34 annotation1893181 1 T7 TE range1893181 1 132 151 annotation1893178 1 BBa_B0010 range1893178 1 37 116 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_B0030_sequence 1 attaaagaggagaaa BBa_J37027_sequence 1 cgataacttggtatagcatacattatacgaacggtaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatagattataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggctctagtagcgatctacactagcactatcagcgttattaagcaccggtggagtgacgaccttcagcacgttcgtactgttcaacgatggtgtagtcttcgttgtgggaggtgatgtccagtttgatgtcggttttgtaagcacccggcagctgaaccggttttttagccatgtaggtggttttaacttcagcgtcgtagtgaccaccgtctttcagtttcagacgcattttgatttcacctttcagagcaccgtcttccgggtacatacgttcggtggaagcttcccaacccatggtttttttctgcataaccggaccgtcggacgggaagttggtaccacgcagtttaactttgtagatgaactcaccgtcttgcagggaggagtcctgggtaacggtaacaacaccaccgtcttcgaagttcataacacgttcccatttgaaaccttccgggaaggacagtttcaggtagtccgggatgtcagccgggtgtttaacgtaagctttggaaccgtactggaactgcggggacaggatgtcccaagcgaacggcagcggaccacctttggtaactttcagtttagcggtctgggtaccttcgtacggacgaccttcaccttcaccttcgatttcgaactcgtgaccgttaacggaaccttccatacgaactttgaaacgcatgaactctttgataacgtcttcggaggaagccatctagtatttctcctctttctctagtagtgctcagtatctctatcactgatagggatgtcaatctctatcactgatagggagttaccgttcgtatacgatacattatacgaagttat BBa_J37038_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagattaaagaggagaaatactagagcgataacttggtatagcatacattatacgaacggtaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatagattataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggctctagtagcgatctacactagcactatcagcgttattaagcaccggtggagtgacgaccttcagcacgttcgtactgttcaacgatggtgtagtcttcgttgtgggaggtgatgtccagtttgatgtcggttttgtaagcacccggcagctgaaccggttttttagccatgtaggtggttttaacttcagcgtcgtagtgaccaccgtctttcagtttcagacgcattttgatttcacctttcagagcaccgtcttccgggtacatacgttcggtggaagcttcccaacccatggtttttttctgcataaccggaccgtcggacgggaagttggtaccacgcagtttaactttgtagatgaactcaccgtcttgcagggaggagtcctgggtaacggtaacaacaccaccgtcttcgaagttcataacacgttcccatttgaaaccttccgggaaggacagtttcaggtagtccgggatgtcagccgggtgtttaacgtaagctttggaaccgtactggaactgcggggacaggatgtcccaagcgaacggcagcggaccacctttggtaactttcagtttagcggtctgggtaccttcgtacggacgaccttcaccttcaccttcgatttcgaactcgtgaccgttaacggaaccttccatacgaactttgaaacgcatgaactctttgataacgtcttcggaggaagccatctagtatttctcctctttctctagtagtgctcagtatctctatcactgatagggatgtcaatctctatcactgatagggagttaccgttcgtatacgatacattatacgaagttattactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z