BBa_J42040 1 BBa_J42040 recomb. backbone 2006-10-30T12:00:00Z 2015-08-31T04:08:48Z Annealed oligonucleotides from Invitrogen This nine site polylinker (EcoRI, SacI, NotI, NdeI, ClaI, BamHI, SalI, XhoI, HindIII) serves as the backbone to the nested landing pad project. The polylinker allows for easy double digest and stepwise construction. false false _81_ 0 1129 81 Not in stock false Polylinker restriction sites must be unique to vector plasmid (modified pBR322) false Steve Selinsky BBa_J42040_sequence 1 gaattcggggagctcggggcggccgcgggcatatggggatcgatgggggatccggggtcgacgggctcgaggggaagctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z