BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_J45100 1 WOG Wintergreen odor enzyme (BSMT1) generator 2006-08-08T11:00:00Z 2015-08-31T04:08:49Z This is made from a biobrick promoter and our biobrick wintergreen generating device. This is the wintergreen generating device hooked up to a constitutive promoter. false false _84_ 0 974 84 It's complicated false See J45099 false Boyuan Zhu component1894586 1 BBa_B0030 component1894581 1 BBa_R0040 component1894591 1 BBa_J45004 component1894594 1 BBa_B0012 component1894592 1 BBa_B0010 annotation1894591 1 BBa_J45004 range1894591 1 84 1157 annotation1894581 1 BBa_R0040 range1894581 1 1 54 annotation1894594 1 BBa_B0012 range1894594 1 1254 1294 annotation1894592 1 BBa_B0010 range1894592 1 1166 1245 annotation1894586 1 BBa_B0030 range1894586 1 63 77 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 BBa_J45004 1 BSMT1 SAM:benzoic acid/salicylic acid carboxyl methyltransferase I; converts salicylic acid to methyl sali 2006-06-06T11:00:00Z 2015-08-31T04:08:49Z Species: Petunia x hybrida from Genbank; (also available: A. thaliana and N. suaveolens) Codes for BSMT enzyme to convert Benzoic acid/salicylic acid to methyl benzoate and methyl salicylate. This part is phBSMT1 from Petunia x hybrida. false false _84_ 0 974 84 It's complicated true Transport issues are being considered. true Boyuan Zhu annotation1880520 1 stop codon range1880520 1 1072 1074 annotation1880519 1 start codon range1880519 1 1 3 annotation1880517 1 BMST1 range1880517 1 1 1074 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J45100_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagattaaagaggagaaatactagatggaagttgttgaagttcttcacatgaatggaggaaatggagacagtagctatgcaaacaattctttggttcagcaaaaggtgattctcatgacaaagccaataactgagcaagccatgattgatctctacagcagcctctttccagaaaccttatgcattgcagatttgggttgttctttgggagctaacactttcttggtggtctcacagcttgttaaaatagtagaaaaagaacgaaaaaagcatggttttaagtctccagagttttattttcacttcaatgatcttcctggcaatgattttaatacactttttcagtcactgggggcatttcaagaagatttgagaaagcatataggggaaagctttggtccatgttttttcagtggagtgcctggttcattttatactagacttttcccttccaaaagtttacattttgtttactcctcctacagtctcatgtggctatctcaggtgcctaatgggattgaaaataacaagggaaacatttacatggcaagaacaagccctctaagtgttattaaagcatactacaagcaatatgaaatagatttttcaaattttctcaagtaccgttcagaggaattgatgaaaggtggaaagatggtgttaacactcctaggtagagaaagtgaggatcctactagcaaagaatgctgttacatttgggagcttctagccatggccctcaataagttggttgaagagggattgataaaagaagagaaagtagatgcattcaatattcctcaatacacaccatcaccagcagaagtaaagtacatagttgagaaggaaggatcattcaccattaatcgcttggaaacatcaagagttcattggaatgcttctaataatgagaagaatggtggttacaatgtgtcaaggtgcatgagagctgtggctgagcctttgcttgtcagccactttgacaaggaattgatggatttagtgttccacaagtacgaagagattgtttctgattgcatgtccaaagagaatactgagtttataaatgtcatcatctccttgaccaaaataaattaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_B0030_sequence 1 attaaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J45004_sequence 1 atggaagttgttgaagttcttcacatgaatggaggaaatggagacagtagctatgcaaacaattctttggttcagcaaaaggtgattctcatgacaaagccaataactgagcaagccatgattgatctctacagcagcctctttccagaaaccttatgcattgcagatttgggttgttctttgggagctaacactttcttggtggtctcacagcttgttaaaatagtagaaaaagaacgaaaaaagcatggttttaagtctccagagttttattttcacttcaatgatcttcctggcaatgattttaatacactttttcagtcactgggggcatttcaagaagatttgagaaagcatataggggaaagctttggtccatgttttttcagtggagtgcctggttcattttatactagacttttcccttccaaaagtttacattttgtttactcctcctacagtctcatgtggctatctcaggtgcctaatgggattgaaaataacaagggaaacatttacatggcaagaacaagccctctaagtgttattaaagcatactacaagcaatatgaaatagatttttcaaattttctcaagtaccgttcagaggaattgatgaaaggtggaaagatggtgttaacactcctaggtagagaaagtgaggatcctactagcaaagaatgctgttacatttgggagcttctagccatggccctcaataagttggttgaagagggattgataaaagaagagaaagtagatgcattcaatattcctcaatacacaccatcaccagcagaagtaaagtacatagttgagaaggaaggatcattcaccattaatcgcttggaaacatcaagagttcattggaatgcttctaataatgagaagaatggtggttacaatgtgtcaaggtgcatgagagctgtggctgagcctttgcttgtcagccactttgacaaggaattgatggatttagtgttccacaagtacgaagagattgtttctgattgcatgtccaaagagaatactgagtttataaatgtcatcatctccttgaccaaaataaattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z