BBa_C0040 1 tetR tetracycline repressor from transposon Tn10 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999) Released HQ 2013 Coding region for the TetR protein without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. TetR binds to the pTet regulator (BBa_R0040). aTc (anhydrotetracycline) binds to TetR and inhibits its operation.</P> false true _1_ 0 24 7 In stock false References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P> References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P>BBa_C0040 TetR Protein is based on the TetR sequence from Elowitz's repressilator. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman. annotation23329 1 tetR range23329 1 4 620 annotation23330 1 SsrA range23330 1 621 654 annotation2213989 1 Help:Barcodes range2213989 1 661 685 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_J45180 1 BBa_J45180 Exponential phase dependent wintergreen odor generator 2006-10-30T12:00:00Z 2015-08-31T04:08:49Z - This is a protein generator that outputs BSMT (benzoic acid/salicylic acid methyl transferase) under control of the osmY stationary phase promoter and Q04400 inverter. Ideally, when in stationary phase, BSMT output is "low" and vice versa. false false _84_ 0 977 84 Not in stock false - false Andr?? Green II component1909163 1 BBa_B0012 component1909153 1 BBa_Q04401 component1909155 1 BBa_B0032 component1909160 1 BBa_J45004 component1909152 1 BBa_J45993 component1909161 1 BBa_B0010 annotation1909155 1 BBa_B0032 range1909155 1 976 988 annotation1909153 1 BBa_Q04401 range1909153 1 66 967 annotation1909163 1 BBa_B0012 range1909163 1 2165 2205 annotation1909152 1 BBa_J45993 range1909152 1 1 57 annotation1909160 1 BBa_J45004 range1909160 1 995 2068 annotation1909161 1 BBa_B0010 range1909161 1 2077 2156 BBa_Q04401 1 tetR inver TetR-derived transcriptional inverter 2006-05-10T11:00:00Z 2015-05-08T01:14:13Z Currently entered as a placeholder. This is a modified version of the tetR inverter Q04400 with a single base switch in the RBS: AAAGAGGAGAAA to AAAGAGGGGAAA false false _11_ 0 253 6 Not in stock false false Josh Michener component2251463 1 BBa_C0040 component2251471 1 BBa_R0040 component2251459 1 BBa_B0064 component2251470 1 BBa_B0015 annotation2251459 1 BBa_B0064 range2251459 1 1 12 annotation2251470 1 BBa_B0015 range2251470 1 712 840 annotation2251471 1 BBa_R0040 range2251471 1 849 902 annotation2251463 1 BBa_C0040 range2251463 1 19 703 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_B0064 1 BBa_B0064 Tuned RBS for Q04401 2008-02-23T12:00:00Z 2015-08-31T04:07:21Z . This is a single bp change from B0034. It's strength is approximately 35% that of B0034. false false _11_ 0 2 84 Not in stock false . false Jason Kelly BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_J45004 1 BSMT1 SAM:benzoic acid/salicylic acid carboxyl methyltransferase I; converts salicylic acid to methyl sali 2006-06-06T11:00:00Z 2015-08-31T04:08:49Z Species: Petunia x hybrida from Genbank; (also available: A. thaliana and N. suaveolens) Codes for BSMT enzyme to convert Benzoic acid/salicylic acid to methyl benzoate and methyl salicylate. This part is phBSMT1 from Petunia x hybrida. false false _84_ 0 974 84 It's complicated true Transport issues are being considered. true Boyuan Zhu annotation1880520 1 stop codon range1880520 1 1072 1074 annotation1880519 1 start codon range1880519 1 1 3 annotation1880517 1 BMST1 range1880517 1 1 1074 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_J45993 1 p(osmY) Minimal stationary phase osmY promoter 2006-07-10T11:00:00Z 2015-08-31T04:08:50Z This part was PCRed out of E. coli's genome. osmY's promoter is active in stationary phase and under high osmotic pressure conditions. false false _84_ 0 642 84 Not in stock true Truncated Forward Primer: 5'- GTT TCT TCG AAT TCG CGG CCG CTT CTA GGCT TAT GTT TTC GCT GAT ATC - 3' Total Length: 49 bp Annealing Length: 21 bp GC Content: 38.1% Melting Temperature: 49.5 degrees C hairpin deltaG: -2.66 kcal/mol self dimer deltaG: -99.97 kcal/mol Reverse Primer: 5'-GTT TCT TCC TGC AGC GGC CGC TAC TAG TAT TGT TAA ATA TAG ATC ACA ATT TTG- 3' Total Length: 54 bp Annealing Length: 25 bp GC Content: 20.0% Melting Temperature: 46.4 degrees C hairpin deltaG: -2.86 kcal/mol self dimer deltaG: -99.44 kcal/mol heterodimer deltaG with Conserved Forward Primer: -99.97 kcal/mol false Stephen Payne annotation1883648 1 -35 range1883648 1 22 27 annotation1883647 1 -10 range1883647 1 46 51 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0064_sequence 1 aaagaggggaaa BBa_J45180_sequence 1 gcttatgttttcgctgatatcccgagcggtttcaaaattgtgatctatatttaacaatactagagaaagaggggaaatactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagtcacacaggaaagtactagatggaagttgttgaagttcttcacatgaatggaggaaatggagacagtagctatgcaaacaattctttggttcagcaaaaggtgattctcatgacaaagccaataactgagcaagccatgattgatctctacagcagcctctttccagaaaccttatgcattgcagatttgggttgttctttgggagctaacactttcttggtggtctcacagcttgttaaaatagtagaaaaagaacgaaaaaagcatggttttaagtctccagagttttattttcacttcaatgatcttcctggcaatgattttaatacactttttcagtcactgggggcatttcaagaagatttgagaaagcatataggggaaagctttggtccatgttttttcagtggagtgcctggttcattttatactagacttttcccttccaaaagtttacattttgtttactcctcctacagtctcatgtggctatctcaggtgcctaatgggattgaaaataacaagggaaacatttacatggcaagaacaagccctctaagtgttattaaagcatactacaagcaatatgaaatagatttttcaaattttctcaagtaccgttcagaggaattgatgaaaggtggaaagatggtgttaacactcctaggtagagaaagtgaggatcctactagcaaagaatgctgttacatttgggagcttctagccatggccctcaataagttggttgaagagggattgataaaagaagagaaagtagatgcattcaatattcctcaatacacaccatcaccagcagaagtaaagtacatagttgagaaggaaggatcattcaccattaatcgcttggaaacatcaagagttcattggaatgcttctaataatgagaagaatggtggttacaatgtgtcaaggtgcatgagagctgtggctgagcctttgcttgtcagccactttgacaaggaattgatggatttagtgttccacaagtacgaagagattgtttctgattgcatgtccaaagagaatactgagtttataaatgtcatcatctccttgaccaaaataaattaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_B0032_sequence 1 tcacacaggaaag BBa_C0040_sequence 1 atgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_J45993_sequence 1 gcttatgttttcgctgatatcccgagcggtttcaaaattgtgatctatatttaacaa BBa_J45004_sequence 1 atggaagttgttgaagttcttcacatgaatggaggaaatggagacagtagctatgcaaacaattctttggttcagcaaaaggtgattctcatgacaaagccaataactgagcaagccatgattgatctctacagcagcctctttccagaaaccttatgcattgcagatttgggttgttctttgggagctaacactttcttggtggtctcacagcttgttaaaatagtagaaaaagaacgaaaaaagcatggttttaagtctccagagttttattttcacttcaatgatcttcctggcaatgattttaatacactttttcagtcactgggggcatttcaagaagatttgagaaagcatataggggaaagctttggtccatgttttttcagtggagtgcctggttcattttatactagacttttcccttccaaaagtttacattttgtttactcctcctacagtctcatgtggctatctcaggtgcctaatgggattgaaaataacaagggaaacatttacatggcaagaacaagccctctaagtgttattaaagcatactacaagcaatatgaaatagatttttcaaattttctcaagtaccgttcagaggaattgatgaaaggtggaaagatggtgttaacactcctaggtagagaaagtgaggatcctactagcaaagaatgctgttacatttgggagcttctagccatggccctcaataagttggttgaagagggattgataaaagaagagaaagtagatgcattcaatattcctcaatacacaccatcaccagcagaagtaaagtacatagttgagaaggaaggatcattcaccattaatcgcttggaaacatcaagagttcattggaatgcttctaataatgagaagaatggtggttacaatgtgtcaaggtgcatgagagctgtggctgagcctttgcttgtcagccactttgacaaggaattgatggatttagtgttccacaagtacgaagagattgtttctgattgcatgtccaaagagaatactgagtttataaatgtcatcatctccttgaccaaaataaattaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_Q04401_sequence 1 aaagaggggaaatactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z