BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_J45992 1 p(osmY) Full-length stationary phase osmY promoter 2006-07-10T11:00:00Z 2015-08-31T04:08:50Z This part was PCRed out of E. coli's genome. osmY's promoter is active in stationary phase and under high osmotic pressure conditions. false false _84_ 0 642 84 Not in stock true Truncated Forward Primer: 5'- GTT TCT TCG AAT TCG CGG CCG CTT CTA GGCT TAT GTT TTC GCT GAT ATC - 3' Total Length: 49 bp Annealing Length: 21 bp GC Content: 38.1% Melting Temperature: 49.5 degrees C hairpin deltaG: -2.66 kcal/mol self dimer deltaG: -99.97 kcal/mol Full Forward Primer: 5'- GTT TCT TCG AAT TCG CGG CCG CTT CTA GCTG GCA CAG GAA CGT TAT C - 3' Total Length: 47 bp Annealing Length: 19 bp GC Content: 52.6% Melting Temperature: 53.4 degrees C hairpin deltaG: -3.99 kcal/mol self dimer deltaG: -98.3 kcal/mol Reverse Primer: 5'-GTT TCT TCC TGC AGC GGC CGC TAC TAG TAT TGT TAA ATA TAG ATC ACA ATT TTG- 3' Total Length: 54 bp Annealing Length: 25 bp GC Content: 20.0% Melting Temperature: 46.4 degrees C hairpin deltaG: -2.86 kcal/mol self dimer deltaG: -99.44 kcal/mol heterodimer deltaG with Forward Primer: -99.44 kcal/mol heterodimer deltaG with Conserved Forward Primer: -99.97 kcal/mol false Stephen Payne annotation1883645 1 -10 range1883645 1 188 193 annotation1883646 1 -35 range1883646 1 164 169 BBa_J45995 1 p(osmY).GF Stationary phase dependent GFP generator 2006-10-30T12:00:00Z 2015-08-31T04:08:50Z J45992 was PCRed out of the E. coli genome, while E0840 was constructed at the Registry of Standard Biological Parts. This part is a composite part consisting of <biobrick>J45992</biobrick/> (a stationary phase promoter) and <biobrick>E0840</biobrick/> (a GFP generator). Thus, this device creates green fluorescent protein in stationary phase. false false _84_ 0 642 84 It's complicated true This part was mainly designed to test whether J45250 would smell like banana only in stationary phase. false Stephen Payne component1909183 1 BBa_B0030 component1909185 1 BBa_E0040 component1909188 1 BBa_B0012 component1909181 1 BBa_J45992 component1909186 1 BBa_B0010 annotation1909188 1 BBa_B0012 range1909188 1 1045 1085 annotation1909185 1 BBa_E0040 range1909185 1 229 948 annotation1909181 1 BBa_J45992 range1909181 1 1 199 annotation1909183 1 BBa_B0030 range1909183 1 208 222 annotation1909186 1 BBa_B0010 range1909186 1 957 1036 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J45992_sequence 1 ctggcacaggaacgttatccggacgttcagttccaccagacccgcgagcattaattcttgcctccagggcgcggtagtggcgccctgtcaatttcccttccttattagccgcttacggaatgttcttaaaacattcacttttgcttatgttttcgctgatatcccgagcggtttcaaaattgtgatctatatttaacaa BBa_B0030_sequence 1 attaaagaggagaaa BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_J45995_sequence 1 ctggcacaggaacgttatccggacgttcagttccaccagacccgcgagcattaattcttgcctccagggcgcggtagtggcgccctgtcaatttcccttccttattagccgcttacggaatgttcttaaaacattcacttttgcttatgttttcgctgatatcccgagcggtttcaaaattgtgatctatatttaacaatactagagattaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z