BBa_J47864 1 BBa_J47864 xylR = xylose transcriptional regulator 2007-06-06T11:00:00Z 2015-08-31T04:08:51Z From chromosomal DNA Regulates based on the presence of xyulose true false _72_ 0 1149 72 Discontinued false No false Luc Weiss BBa_J47864_sequence 1 atcccagaattggccagataacag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z