BBa_J49003 1 BBa_J49003 Gene to make a motorcycle 2006-06-14T11:00:00Z 2015-08-31T04:08:51Z Draws inspiration from Henry's Moustache This part makes a motorcycle under the influence of the bicycle dependent promoter. false false _74_ 0 704 74 Not in stock false the fact that testosterone does not make a bicycle false Ritu Kamal annotation1880743 1 MtrC range1880743 1 1 35 BBa_J49003_sequence 1 aaaaaattggaatatatatatatatgcgcgcagatgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z