BBa_J49013 1 BBa_J49013 Squash-improves-English-Diet ... Module 2006-06-14T11:00:00Z 2015-08-31T03:54:03Z A bunker in Soviet Russia. read the description dude!! That's what it does. The nutrition promoter results in expression of the tSquash sequence. false false _74_ 0 706 74 Not in stock false Ze Germans. false Wei Ho component1880783 1 BBa_J49007 component1880782 1 BBa_B0021 component1880780 1 BBa_B0030 annotation1880782 1 BBa_B0021 range1880782 1 24 69 annotation1880783 1 BBa_J49007 range1880783 1 78 80 annotation1880780 1 BBa_B0030 range1880780 1 1 15 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_J49007 1 BBa_J49007 tSquash (Coding sequence for expression of Butternut Squash) 2006-06-14T11:00:00Z 2015-08-31T03:54:03Z North American Indian Reservations. They like squash... and they thought they had given the brits a taste of squash at Jamestown! This sequence codes for a protein that activates the long-dormant potential for British subjects to spontaneously transform into Butternut Squash (scientific name "bollocks"). Research into this phenomenon is currently inhibited by the vegetable status of many of the UK's top scientists. false false _74_ 0 713 74 Not in stock false Turning Wayne Rooney into a vegetable? He really didn't need help, but his head is better suited looking like a squash. Consumption of the delicious Butternut Squash subjects by the scientists and the subsequent moral dilemmas about definition of cannibalism. false Safiyi Momen BBa_B0021 1 BBa_B0021 LuxICDABEG (+/-), reversed 2003-10-13T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Bidirectional transcriptional terminator cloned in the reverse direction of B0011. 22 bp stem-loop false true _1_ 0 24 7 In stock false Cloned with primer-dimers into pSB1A2 true Caitlin Conboy annotation7024 1 BBa_B0021 range7024 1 1 46 BBa_B0021_sequence 1 aaataataaaaaagccggattaataatctggctttttatattctct BBa_B0030_sequence 1 attaaagaggagaaa BBa_J49013_sequence 1 attaaagaggagaaatactagagaaataataaaaaagccggattaataatctggctttttatattctcttactagagtag BBa_J49007_sequence 1 tag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z