BBa_J49015 1 BBa_J49015 Motorcycle adolescence module 2006-06-14T11:00:00Z 2015-08-31T03:54:03Z BBa_J49003 and BBa_J49001 This is the composite output module comprised of the testosterone promoter and the motorcycle gene. false true _74_ 0 704 74 Not in stock false Again, just the fact that Bicyclus bicyclus is not made from testosterone. Oh well. false Ritu Kamal component1880773 1 BBa_B0012 component1880767 1 BBa_J49001 component1880772 1 BBa_J49003 component1880769 1 BBa_B0030 annotation1880772 1 BBa_J49003 range1880772 1 121 157 annotation1880773 1 BBa_B0012 range1880773 1 166 206 annotation1880769 1 BBa_B0030 range1880769 1 98 112 annotation1880767 1 BBa_J49001 range1880767 1 1 89 BBa_J49003 1 BBa_J49003 Gene to make a motorcycle 2006-06-14T11:00:00Z 2015-08-31T04:08:51Z Draws inspiration from Henry's Moustache This part makes a motorcycle under the influence of the bicycle dependent promoter. false false _74_ 0 704 74 Not in stock false the fact that testosterone does not make a bicycle false Ritu Kamal annotation1880743 1 MtrC range1880743 1 1 35 BBa_J49001 1 BBa_J49001 Testosterone dependent promoter for species Bicyclus Bicyclus 2006-06-14T11:00:00Z 2015-08-31T04:08:51Z Henry's Mustache This part will be used to turn young bicycles into mature motorcycles ready to take on the world. VROOM! false false _74_ 0 709 74 Not in stock false Do not mix with alcohol. false John Mangual annotation1880742 1 binding site range1880742 1 1 12 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_J49003_sequence 1 aaaaaattggaatatatatatatatgcgcgcagatgc BBa_J49015_sequence 1 aggactagataggacacagattagacgagatacccagatacgatagacgatagggatagaccatagactagaacgatactagactacgatactagagattaaagaggagaaatactagagaaaaaattggaatatatatatatatgcgcgcagatgctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0030_sequence 1 attaaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J49001_sequence 1 aggactagataggacacagattagacgagatacccagatacgatagacgatagggatagaccatagactagaacgatactagactacga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z