BBa_J51001 1 BBa_J51001 ComA 2006-10-24T11:00:00Z 2015-08-31T03:54:04Z This part was PCR amplified from B. subtilis 168 genomic DNA. ComA is the reponse regulator of the ComQXPA quorum-sensing system of Bacillus subtilis. In the presence of extracellular ComX pheromone (a secreted 10-residue modified peptide), ComP binds to ComX and activates ComA by phosphorylation. ComA-p then binds to specific promoter sequences and activated transcription of a number of genes. NOTE: The ComA part described herein contains an internal SpeI site, which prevents cloning using standard assembly. For information on the DNA binding sequence for ComA can be found in: J. Bacteriology (1993) 175(10), 3182-3187. For details about the ComQXPA system of quorumtaxis, see: Molecular Microbiology (2005) 57(4), 1159???1174. false false _75_ 0 948 75 Not in stock false NOTE: The Biobrick prefix and suffix sites are non-standard! Due to the high percentage of A+Ts in the ComQXPA genes, the primer hybridization sites were lengthened and the Biobrick sites correspondingly shortened (the NotI sites between the E-X and S-P restriction sites was removed). Primers used for sequencing (5'->3') F: cggaattccctctagATGAAAAAGATACTAGTGATTGATGACCATCCGG R: gactgcagctactagTTAAAGTACACCGTCTGATTTCGCAATC NOTE: The ComA part contains an internal SpeI site, which prevents cloning using standard assembly. This will be removed by site-directed mutagenesis in the future. false Peter Nguyen BBa_J51001_sequence 1 atgaaaaagatactagtgattgatgaccatccggctgtcatggaaggcaccaagacaattttggaaacggattcgaatttgtctgttgattgtctcagtcctgaaccgagcgaacagtttatcaagcagcatgatttctcgtcatatgatctcattttaatggatctgaatctaggcggcgaggtcaatgggatggagctttctaaacagattttacaagagaatcctcattgtaaaattatcgtgtataccggttatgaggtcgaggattatttcgaggaagcgattcgtgcgggtctgcacggtgccatcagcaaaacggaatctaaagaaaagatcacccaatacatataccacgtactcaacggagaaattttagtcgattttgcttactttaaacagctgatgactcagcaaaaaacaaagccggctccttcctctcaaaaagaacaagatgtgctcacacctagagaatgcctgattcttcaagaagttgaaaagggatttacaaaccaagaaatcgcagatgcccttcatttaagcaagcggtccattgaatacagcttgacatcgattttcaataagctgaatgtcggttcacggacggaagcggttttgattgcgaaatcagacggtgtactttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z