BBa_J52007 1 BBa_J52007 PEST seqence 2006-08-03T11:00:00Z 2015-08-31T03:54:04Z genomic PEST seqence for degradation of proteins in mamalian cells true false _80_ 0 855 80 Discontinued false no false Jelka Pohar annotation1893577 1 pest range1893577 1 1 20 BBa_J52007_sequence 1 tgacttgctagcggtactgttagtcagtcgtatcatcgtacgttgggatcgtagctagtcggttaagtcga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z