BBa_J54015 1 BBa_J54015 Protein Binding Site_LacI 2006-10-14T11:00:00Z 2015-08-31T03:48:11Z DNA synthesis Regulator false true _76_ 0 762 76 Not in stock false As Repressor false Yusaku Nakashima annotation1903167 1 BglII range1903167 1 30 35 annotation1903166 1 LacI_Binding_Site range1903166 1 6 29 BBa_J54015_sequence 1 gatcggaattgtgagcggataacaattccagatctatcgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z