BBa_J54016 1 BBa_J54016 promoter_lacq 2006-10-14T11:00:00Z 2015-08-31T03:48:11Z DNA synthesis lacq promoter false false _76_ 0 762 76 Not in stock false As Promoter false Yusaku Nakashima annotation1903168 1 BamHI range1903168 1 12 17 annotation1903169 1 promoter_lacq range1903169 1 18 49 BBa_J54016_sequence 1 tcgaccgtgacggatcctggtgcaaaacctttcgcggtatggcatgatagcgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z