BBa_J54014 1 BBa_J54014 Surrfix_BglII,MluI(TokyoStanderd) 2006-10-14T11:00:00Z 2015-08-31T03:48:11Z BglII,MulI site Surrfix_BglII,MluI false false _76_ 0 762 76 Not in stock false As suffix false Yusaku Nakashima annotation1903162 1 BglII range1903162 1 1 6 annotation1903163 1 MluI range1903163 1 15 20 BBa_J54017 1 BBa_J54017 promoter_always 2006-10-14T11:00:00Z 2015-08-31T03:48:11Z It comes from BBa_J54013-J54015 promoter expresses always false false _76_ 0 762 76 Not in stock false as promoter false Yusaku Nakashima component1903172 1 BBa_J54013 component1903175 1 BBa_J54014 component1903178 1 BBa_J54015 annotation1903178 1 BBa_J54015 range1903178 1 57 98 annotation1903175 1 BBa_J54014 range1903175 1 29 48 annotation1903172 1 BBa_J54013 range1903172 1 1 20 BBa_J54015 1 BBa_J54015 Protein Binding Site_LacI 2006-10-14T11:00:00Z 2015-08-31T03:48:11Z DNA synthesis Regulator false true _76_ 0 762 76 Not in stock false As Repressor false Yusaku Nakashima annotation1903167 1 BglII range1903167 1 30 35 annotation1903166 1 LacI_Binding_Site range1903166 1 6 29 BBa_J54013 1 BBa_J54013 Prefix_SalI, BamHI(TokyoStanderd) 2006-10-14T11:00:00Z 2015-08-31T03:48:11Z Restriction Enzyme site Prefix false true _76_ 0 762 76 Not in stock false As Prefix false Yusaku Nakashima annotation1903165 1 BamHI range1903165 1 15 20 annotation1903164 1 SalI range1903164 1 1 6 BBa_J54014_sequence 1 gagatctgtcggataacgcg BBa_J54013_sequence 1 gtcgactgacgactggatcc BBa_J54015_sequence 1 gatcggaattgtgagcggataacaattccagatctatcgtaa BBa_J54017_sequence 1 gtcgactgacgactggatcctactagaggagatctgtcggataacgcgtactagaggatcggaattgtgagcggataacaattccagatctatcgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z