BBa_J54021 1 BBa_J54021 PrefixI_SalI 2006-10-14T11:00:00Z 2015-08-31T03:48:11Z DNA synthesis Restriction Enzyme site false false _76_ 0 762 76 Not in stock false AS Prefix false Yusaku Nakashima annotation1903197 1 SalI range1903197 1 18 22 BBa_J54021_sequence 1 cgcggccgcttctagaggtcga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z